Need Help?

The function of LAMP5 in multiple myeloma

This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

Request Access

MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

These terms and conditions govern access to the managed access datasets (details of which are set out in Appendix I) to which the User Institution has requested access. The User Institution agrees to be bound by these terms and conditions.

Studies are experimental investigations of a particular phenomenon, e.g., case-control studies on a particular trait or cancer research projects reporting matching cancer normal genomes from patients.

Study ID Study Title Study Type
EGAS50000000802 RNASeq

This table displays only public information pertaining to the files in the dataset. If you wish to access this dataset, please submit a request. If you already have access to these data files, please consult the download documentation.

ID File Type Size Located in
EGAF50000289757 fastq.gz 2.0 GB
EGAF50000289758 fastq.gz 1.9 GB
EGAF50000289759 fastq.gz 1.9 GB
EGAF50000289760 fastq.gz 2.0 GB
EGAF50000289761 fastq.gz 2.3 GB
EGAF50000289762 fastq.gz 2.4 GB
EGAF50000289763 fastq.gz 2.0 GB
EGAF50000289764 fastq.gz 2.1 GB
EGAF50000289765 fastq.gz 1.9 GB
EGAF50000289766 fastq.gz 2.0 GB
EGAF50000289767 fastq.gz 2.0 GB
EGAF50000289768 fastq.gz 2.1 GB
EGAF50000289769 fastq.gz 2.1 GB
EGAF50000289770 fastq.gz 2.2 GB
EGAF50000289771 fastq.gz 1.9 GB
EGAF50000289772 fastq.gz 2.0 GB
EGAF50000289773 fastq.gz 2.1 GB
EGAF50000289774 fastq.gz 2.2 GB
EGAF50000289775 fastq.gz 2.0 GB
EGAF50000289776 fastq.gz 2.0 GB
EGAF50000289777 fastq.gz 2.0 GB
EGAF50000289778 fastq.gz 2.1 GB
EGAF50000289779 fastq.gz 2.3 GB
EGAF50000289780 fastq.gz 2.4 GB
EGAF50000289781 fastq.gz 1.9 GB
EGAF50000289782 fastq.gz 2.0 GB
EGAF50000289783 fastq.gz 1.9 GB
EGAF50000289784 fastq.gz 1.9 GB
EGAF50000289785 fastq.gz 1.9 GB
EGAF50000289786 fastq.gz 1.9 GB
EGAF50000289787 fastq.gz 2.0 GB
EGAF50000289788 fastq.gz 2.0 GB
EGAF50000289789 fastq.gz 1.9 GB
EGAF50000289790 fastq.gz 1.9 GB
EGAF50000289791 fastq.gz 2.4 GB
EGAF50000289792 fastq.gz 2.4 GB
EGAF50000289793 fastq.gz 2.0 GB
EGAF50000289794 fastq.gz 2.0 GB
EGAF50000289795 fastq.gz 2.1 GB
EGAF50000289796 fastq.gz 2.2 GB
EGAF50000289797 fastq.gz 1.9 GB
EGAF50000289798 fastq.gz 2.0 GB
EGAF50000289799 fastq.gz 2.3 GB
EGAF50000289800 fastq.gz 2.4 GB
EGAF50000289801 fastq.gz 2.0 GB
EGAF50000289802 fastq.gz 2.0 GB
EGAF50000289803 fastq.gz 1.9 GB
EGAF50000289804 fastq.gz 1.9 GB
EGAF50000289805 fastq.gz 2.0 GB
EGAF50000289806 fastq.gz 2.1 GB
EGAF50000289807 fastq.gz 2.0 GB
EGAF50000289808 fastq.gz 2.1 GB
EGAF50000289809 fastq.gz 1.9 GB
EGAF50000289810 fastq.gz 2.0 GB
EGAF50000289811 fastq.gz 1.9 GB
EGAF50000289812 fastq.gz 2.0 GB
EGAF50000289813 fastq.gz 2.0 GB
EGAF50000289814 fastq.gz 2.1 GB
58 Files (118.4 GB)