7205 results for "({!join from=dataset_studies to=id v=$q1}) OR ("transcriptome" OR "RNA-seq" OR "rna sequencing" OR "rna-sequencing")"

in 20.38 milliseconds.

• Onco-exaptation of an Endogenous Retroviral LTR Drives IRF5 Expression in Hodgkin Lymphoma

  The transcription factor interferon regulatory factor 5 (IRF5) is upregulated in Hodgkin lymphoma (HL) and a key regulator of the aberrant transcriptome characteristic of this disease. Here we show that IRF5 upregulation in HL is driven by transcriptional activation of a normally dormant endogenous retroviral LOR1a long terminal repeat (LTR) upstream of IRF5. Specifically, through screening of RNA-seq libraries, we detected LTR-IRF5 chimeric transcripts in multiple HL cell lines but not in normal B-cell controls. In HL, the LTR was in an open and hypomethylated epigenetic state and we further show the LTR is the site of transcriptional initiation. Among HL cell lines, usage of the LTR promoter strongly correlates with overall levels of IRF5 mRNA and protein, indicating that LTR transcriptional awakening is a major contributor to IRF5 upregulation in HL. Taken together, oncogenic IRF5 overexpression in HL is the result of a specific LTR transcriptional activation. We propose that such LTR derepression is a distinct mechanism of oncogene activation (“onco-exaptation”) and that such a mechanism warrants further investigation in molecular and cancer research.

  Study EGAS00001001205

• 'KOREAN' never-smoker female adenocarcinoma RNA-seq

  Multi-layered genomic studies such as the TCGA project have greatly advanced our understanding on molecular pathogenesis of lung cancer. For Asian nonsmoker patients, however, majority of studies have been limited to mutational analyses, emphasizing ethnic differences in driver mutations (e.g. more frequent EGFR mutations and ALK fusions). In essence, a comprehensive multi-layered characterization that could lead to molecular etiology and patient stratification scheme to be translated into clinical applications for this patient group is still missing. Here we report molecular profiling of tumor and matched normal tissues from 114 non-small-cell lung adenocarcinoma patients using whole exome sequencing, transcriptome sequencing, and array comparative genomic hybridization (CGH).

  Study EGAS00001003789

• Gene Expression of Small Cell Carcinoma of the Ovary-Hypercalcemic Type (SCCOHT)

  Small cell carcinoma of the ovary-hypercalcemic type (SCCOHT) is a rare and aggressive form of ovarian cancer afflicting young women at a median age of 24 years. SCCOHTs are characterized by loss of protein expression of SWI/SNF chromatin remodeling ATPases SMARCA4 and SMARCA2 through mutation and epigenetic silencing, respectively. This study aims to establish gene expression profiles of this cancer through RNA-Seq of fourteen pathologically confirmed cases of SCCOHT tumors.

  Study phs001528

• Prospective Procurement of Solid Tumor Tissue to Identify Novel Therapeutic Targets

  Recent advances and insights into the molecular pathogenesis of cancer have led to the development of novel molecular and biologic targeted therapies for the treatment of advanced cancer patients. A critical challenge in extending these studies involves the identification and validation of new therapeutic targets for future cancer therapies. In this study, we performed whole exome and RNA-Seq analysis metastases to determine the nature and frequency of somatic mutations.

  Study phs001003

• Reference Profiles of ExRNAs in Normal Human Pregnancy

  In this study, we did a comprehensive exRNA profiling of plasma and serum specimens from healthy pregnant women, sampled at different gestational time points, and including subjects with diverse geographical and ethnic backgrounds. This study also contains samples from male and female healthy donors to provide a baseline. The aim of this study is to identify miRNAs that can predict the gestation age and to build a miRNA profile across gestation using small RNA-seq data.

  Study phs003182

• Blood Gene Signatures Associated with Stiffness After TKA

  In this study, we used PAXgene Blood RNA tubes collected from patients undergoing total knee arthroplasty (TKA) for osteoarthritis. Samples were collected with IRB approval and patient consent. We identified 8 patients with knee stiffness after TKA (cases) and 10 patients without post-TKA stiffness (controls). We isolated RNA from cases and controls for RNA-seq analyses, comparing samples collected the day of surgery and samples collected at 24 hours after surgery.

  Study phs002927

• RNAseq of 76 samples from Uveal Melanoma tumors

  Hotspot mutations in the spliceosome gene SF3B1 are reported in 20% of uveal melanomas. SF3B1 is involved in 3'-splice site (3'ss) recognition during RNA splicing; however, the molecular mechanisms of its mutation have remained unclear. Here we show, using RNA-Seq analyses of uveal melanoma, that the SF3B1 R625/K666 mutation results in deregulated splicing at a subset of junctions, mostly by the use of alternative 3'ss

  Study EGAS00001002932

• Genetic regulation of RNA splicing in human pancreatic islets

  Genetic variants that influence transcriptional regulation in pancreatic islets play a major role in the susceptibility to type 2 diabetes (T2D). For many susceptibility loci, however, the mechanisms are unknown. To this end, we examined splicing and gene expression QTLs (sQTLs and eQTLs) in pancreatic islets from 399 human donors from publicly available cohorts and in-house data. Here we provide newly generated RNA-seq data and genotyping array data from 101 donors.

  Study EGAS00001006440

• BBMRI – BIOS – Freeze 2 – RNA-seq Counts

  Read counts determined using HTSeq-count for the BBMRI BIOS Freeze 2 RNAseq data

  Dataset EGAD00010001420

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495