4984 results for "*oma"

in 51.91 milliseconds.

• Yale SPORE in Skin Cancer Project 2

  Understanding the relationship between tumor and peripheral immune environments could allow longitudinal immune monitoring in cancer. Here, we examined whether T cells that share the same TCRab and are found in both tumor and blood can be interrogated to gain insight into the ongoing tumor T cell response. Paired transcriptome and TCRab repertoire of circulating and tumor-infiltrating T cells were analyzed at the single cell level from matched tumor and blood from patients with metastatic melanoma. The data shared here consist of gene expression matrix and fastq files obtained from sequencing single-cell libraries generated with the Chromium (TM) 5' technique. For each of 18 immunotherapy naive and 11 previously treated melanoma patients, T cells (Live/CD45+/TcRab+) were FACS-sorted from PBMCs and freshly resected tumors. Metadata associated with each individual cell consist of Patient I.D., biological sex, immunotherapy status, amino acid and nucleotide CDR3 sequence of the TCR alpha and beta chain (obtained from matched VDJ region enriched libraries), and sequencing batch. Further details about previous treatment history and other clinical parameters can be found in the associated manuscripts (Lucca et al., 2021: PMID: 33651881; Lu et al., PMID: 39609626).

  Study phs002289

• MDACC GBM Data Access Committee

  Retrospective global-omics analyses of an anti-PD-L1 treated cohort of newly diagnosed glioblastoma.

  Dac EGAC50000000477

• Melanoma Genome Sequencing Project

  Melanoma is the most prevalent cause of skin cancer morbidity and mortality. In order to characterize the full range of somatic mutations that may drive the growth of melanoma, we are sequencing tumor and normal DNA from a set of roughly 150 melanomas. For the majority of samples (approximately 90% of the cases), mutations in protein coding genes will be assessed in the exonic DNA of tumor-normal pairs using hybrid capture and paired-end DNA sequencing. For a few of DNA samples (approximately 10% of the cases), the entire genomes will be analyzed to assess the possible contribution of complex structural rearrangements contributing to oncogenesis. The sequencing data are supplemented by copy number profiling on the same tumors using high-density SNP arrays. Integration of these approaches will enable the unbiased and comprehensive characterization of both known and novel recurrent DNA alterations that arise in melanoma.Versions 1-4 contain whole exome and bulk RNA sequencing data for patients with melanoma.Version 5 - We compared somatic genomic profiles from matched pre-treatment and post-resistance tumor biopsies in patients with metastatic melanoma who exhibited heterogeneous responses to immune checkpoint inhibitors (ICIs). This version includes whole exome sequencing (WES) data from 14 patients.

  Study phs000452

• Identification of Novel Immunotherapy Targets in Myeloma

  RNA sequencing (RNA-Seq) was performed on 94 multiple myeloma (MM) patient samples. We used genomic subgroup and high-risk markers to identify therapeutic targets, including TNFRSF17, GPRC5D, ITGA4, and LAX1, with low predicted toxicity and high specificity to MM and genomic subgroups such as those with TP53 alterations.

  Study phs003772

• MDACC Lymphoma & Myeloma WGS of Tumor and Non-tumor Cells in Multiple Myeloma

  FastQ files from paired tumor and non-tumor WGS data from patients diagnosed with newly diagnosed (n = 6), refractory/relapsed multiple myeloma (n = 3) or plasma cell leukemia (n = 1). These samples presented >95% tumor PCs in bone marrow aspirates. Plasma cells and T cells (non-tumor cells) were isolated from bone marrow aspirates using a magnetic approach.

  Dac EGAC50000000282

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• MDACC Lymphoma & Myeloma scRNAseq of Plasma Cells in Multiple Myeloma

  FastQ files from Chromium single cell 5' gene expression and B-cell receptor sequencing of plasma cells from patients diagnosed with a monoclonal gammopathy of the multiple myeloma spectrum, including the precursor stages MGUS (n =13) and SMM (n = 22); newly diagnosed (n = 17); relapsed (n = 15); and plasma cell leukemia (n = 2); and 3 controls.

  Dac EGAC50000000271

• International Cancer Proteogenome Consortium (ICPC): Proteogenomics of Oral Squamous Cell Carcinoma in Taiwan

  Oral cavity squamous cell carcinoma (OSCC) is the major subtype (~90%) of oral cancer, which is leading cancer with high mortality worldwide. The environmental risk factors associated with OSCC are quite different in Taiwan as compared to other populations. In most non-Taiwanese populations, OSCC is often associated with tobacco chewing, cigarette smoking, alcohol drinking, or human papillomavirus (HPV) infection. In Taiwan, in contrast, the OSCC occurs mainly in males aged 30 years or older who have habitual betel nut chewing, cigarette smoking, and alcohol drinking. To uncover molecular mechanisms and identify new therapeutic strategies of oral squamous cell carcinoma, this study recruited 112 treatment-naïve OSCC patients and generated multi-omics data, including WES, RNA-Seq, TMT-labeled proteomes, and phosphoproteomes from paired normal/tumor tissues. We have investigated our multi-omics data, covering molecular characterizations such as mutation signatures, impacts of mutations on RNA/protein/phosphoprotein, RNA-protein correlation, somatic copy number alteration, and the relationship with RNA & protein, proteome, and phosphoproteome analysis (T vs NAT), novel peptides (somatic variants, neoantigens, CT antigens, T cell receptors, etc.), as well as molecular subtyping (& pathway analysis). Notably, we have discovered a higher frequency of APOBEC3B deletion polymorphism in the Taiwanese population, and APOBEC3A is a potential prognostic biomarker. Our proteogenomic data enable us to further stratify patients into four groups based on APOBE3A expression level, which is found inversely correlated with EGFR expression. Therefore, the patients with high EGFR and low APOBEC3A expression may benefit from anti-EGFR therapy, while those with low EGFR and high APOBEC3A expression may benefit from immunotherapy. To clarify if there is an interaction between genetic polymorphisms and betel nut chewing habit in Taiwanese OSCC, we plan to concurrently evaluate the effect of habitual betel nut chewing on the gene mutation pattern, the dysregulated protein/phosphoproteins as novel biomarkers and/or therapeutic targets, and the molecular subtyping of patients for effective treatments. 

  Study phs002580

• Childhood Cancer Data Initiative (CCDI): Pediatric In Vivo Testing Program - Neuroblastoma

  The goal of NCI's Pediatric In Vivo Testing Consortium (PIVOT) is to advance the development of effective treatments for pediatric cancers through preclinical in vivo testing of novel therapeutic agents. To design impactful experiments that can be rapidly translated to the clinic, PIVOT investigators require comprehensive genomic characterization of the patient-derived xenograft (PDX) models used across the consortium. This robust experimental design enhances collaboration with industry partners by providing proof-of-concept data for drugs in development. As part of this effort, neuroblastoma PDX models are being molecularly characterized to identify promising therapeutic candidates. The molecular profiling includes whole exome sequencing (WES), RNA-seq, MethylEPIC array, CytoSNP array, and DNA fingerprinting for quality control. Additionally, demographic and clinical data (e.g., diagnosis, disease site, disease status) are shared. These characterized PDX models, matched with patient tumors, guide model selection for preclinical drug testing.

  Study phs003163

• TIGER-LC High-Throughput Sequencing

  Intrahepatic cholangiocarcinoma (CCA) and hepatocellular carcinoma (HCC) are clinically disparate primary liver cancers with etiological and biological heterogeneity. We performed sequencing on multiple data levels of Thai CCA and HCC among the Thailand Initiative in Genomics and Expression Research for Liver Cancer (TIGER-LC) cohort using targeted OncoVar platform, whole exome, whole transcriptome, and whole genome metagenomic sequencing.

  Study phs001199

• A Clone's Genomic Stability as a Biomarker of Its DNA-Damage Resilience

  A main problem in the treatment of advanced cancers, including gastric cancers and glioblastoma, is the incertitude at which we predict how individual patients will respond to DNA-damaging agents, especially on the long run. Knowing the mechanism behind a patient's response, or the lack thereof, will help us depart from the oversimplified “more-is-better” and “one-size-fits-all” principles according to which DNA-damaging agents are administered. This will improve clinical outcome by allowing us to pinpoint those who would respond better and longer to lower doses than to higher doses of DNA-damaging agents. Under the assumption that the success of DNA-damaging therapy increases with the proliferation rate of a relatively homogeneous tumor population, there was little reason to assume anything other than monotonic dose-response relations. With the recent paradigm shift that most cancers are in fact DNA mosaic products of ongoing evolution, comes the urgency to reconsider these fundamental principles behind DNA-damaging therapy administration. As the developers of one of the first DNA deconvolution methods and with access to technologies to profile the transcriptomes of up to 10,000 cells simultaneously, we are equipped to embark on first personalized dose-finding strategies for DNA-damaging therapies. We will test the potential of the very long-term legacy that DNA-damage entails on a cell “genomic instability” as new biomarker of DNA-damage response. Our preliminary studies showed that, for most cancer types, DNA-damaging agents change a clone's genomic instability and that clones succumb to a limit in the amount of genomic instability they can tolerate. In particular, our results showed that patients with intermediate genomic instability have a very poor outcome and that this relation is only evident among treatment-naive patients, but not among patients treated with DNA-damaging agents. Further they show that we can measure genomic instability per clone and that clones with extreme genomic instability typically don't grow large. Our hypothesis that genomic instability, rather than proliferation rate, determines how sensitive a tumor is to DNA-damaging agents on the long-term, is founded on two unexpected findings. Patients with extremely high genomic instability per tumor clone have an exceptionally good outcome. Aim 1 will integrate exome- and single cell RNA-Seq (scRNA-Seq) data to characterize clones and to measure how much genomic instability they can tolerate. Low genomic instability is associated with reduced benefit from DNA-damaging agents. Aim 2 will use comet assays and treatment history to quantify DNA damage per clone, relating it to the clones' ability to tolerate DNA damage and to changes in the genomic instability of therapy-surviving clones.

  Study phs003762

• Assessing Individual Head and Neck Squamous Cell Carcinoma Patient Response to Therapy Through Integration of Functional and Genomic Data

  This study combines RNA sequencing (RNASeq), whole exome sequencing (WES), reverse phase protein array (RPPA) and copy number variation (CNV) data, along with a custom high throughput inhibitor assay to characterize tumor cells from patients with head and neck squamous cell carcinoma (HNSCC), in order to identify potential therapy targets on an individual patient basis. The data that will be available through dbGaP include the RNASeq, WES, RPPA and array CNV data for the tumor and matched normal samples. This study represents a proof-of-concept. No treatments were administered to patients as part of this study.

  Study phs003456

• Metabolic Biomarkers in Thoracic Cancers

  Here we present RNA sequencing (RNA-Seq) of non-small cell lung cancer (NSCLC) and adjacent lung tissue. These samples were acquired from primarily untreated, surgically resected primary tumors. The first analysis published with this data was to determine the metabolic signatures between primary tumors and adjacent lung tissue.The associated clinical trial (NCT02095808) includes patients with many kinds of thoracic cancers, including NSCLC and other diseases, such as thymoma and esophageal adenocarcinoma. However, the current dbGaP data is focused on the NSCLCs described in the associated paper.

  Study phs003880

• A Personalized Neoantigen Vaccine Generates Anti-Tumor Immunity in High-Risk Renal Cell Carcinoma

  Personalized cancer vaccines (PCVs) can generate circulating immune responses against predicted neoantigens. However, whether such responses can target cancer driver mutations, lead to immune recognition of a patient's tumor, and result in clinical activity are largely unknown, particularly in patients with lower mutation burden tumors. We conducted a phase I trial testing a neoantigen-targeting PCV in patients with high-risk, fully resected clear cell renal cell carcinoma (RCC; stage III or IV), with or without ipilimumab administered adjacent to the vaccine. At a median follow-up of 40.2 months from surgery, none of the 9 initial participants experienced a recurrence of RCC. No dose-limiting toxicities were observed. All patients generated T cell immune responses against PCV antigens, including RCC driver mutations in VHL, PBRM1, BAP1, KDM5C, and PIK3CA. Following vaccination, there was a durable expansion of peripheral T cell clones, and T cell reactivity against autologous tumor was detected in 7 of the 9 patients. Our results demonstrate that neoantigen-targeting PCVs in high-risk RCC are highly immunogenic, capable of targeting key driver mutations, and induce anti-tumor immunity. These observations, in conjunction with the absence of recurrence in all 9 vaccinated patients, highlights the promise of PCV as effective adjuvant therapy in RCC. We are submitting WES data from whole blood samples and tumor FFPE samples, and RNA-Seq data from tumor FFPE samples. We are also submitting RNA-Seq data from purified tumor samples. scRNA-seq data will be submitted for skin samples (vaccine site biopsies at Weeks 0, 4, and 13), tumor samples (including resected metastatic tumor samples for two patients), and normal kidney samples. Bulk TCR-seq data will be submitted for blood samples.

  Study phs003710

• CD4 T Cell Subsets in Human Metastatic Melanoma

  We used single-cell RNA-sequencing (scRNA-seq) to define CD4+ T-cell subsets in melanoma tumors from patients undergoing tumor resection. All patients received immune checkpoint blockade prior to surgery. We identified multiple subsets in the tumor with transcriptional features of suppressive function, including TR1 cells and FOXP3+ Treg cells. Based on transcriptional profiles, classical helper T cell subsets were not prevalent.

  Study phs003816

• Spatial Transcriptomics of Vaccine Therapy With or Without Cyclophosphamide in Treating Patients Undergoing Chemotherapy and Radiation Therapy for Stage I or Stage II Pancreatic Cancer That Can Be Removed by Surgery

  Pancreatic ductal adenocarcinoma (PDAC) is a rapidly progressing cancer that responds poorly to immunotherapies. Intratumoral tertiary lymphoid structures (TLS) have been associated with rare long-term PDAC survivors, but the role of TLS in PDAC and their spatial relationships within the context of the broader tumor microenvironment remain unknown. Here, spatial transcriptomics data were generated from 16 pancreatic cancer patients treated with GVAX, whose tumors presented with induced intratumoral TLS. Resected tumor specimens were embedded in OCT media and freshly frozen. Sections were cut into 6.5 x 6.5 mm dimensions compatible with Visium spatial transcriptomics slides. TLS-positive tumor sections from 14 patients (14 tumor samples in total) and lymph nodes from remaining patients (2 lymph node samples in total) were selected by an expert pathologist for profiling. We used 4 Visium slides and covered the 16 capture areas with sections cut in a cryostat at 10 µm. The fresh frozen Visium protocol was followed according to manufacturer's recommendations (10x Genomics Spatial 3' v1). Tissue permeabilization and library construction was carried out according to the manufacturer's protocols. Permeabilization time was optimized to 30 minutes. The captured tissue sections were permeabilized to allow RNA to be captured onto the slide where it reverse-transcribed to cDNA. The cDNA was then amplified, and sequencing libraries were prepared using the 10x Genomics Visium Spatial Gene Expression Reagent Kit for Library Preparation. The libraries were then sequenced using an Illumina NovaSeq sequencer. The raw data obtained from the sequencing were processed using the SpaceRanger (spaceranger-1.2.0) pipeline for alignment onto the GRCh38-2020-A reference transcriptome quantification of gene expression. Unsupervised learning generated a TLS-specific spatial gene expression signature that significantly associates with improved survival in PDAC patients. These analyses demonstrate TLS-associated intratumoral B cell maturation.

  Study phs003862

• Developing Targeted Therapy for Patients with Multiple Myeloma and Gain or Amplification of Chr1q (1q+)

  Multiple myeloma (MM) frequently presents with gain or amplification of chr1q (1q+), which is associated with inferior response to treatment and poor outcomes. To develop targeted therapy for MM with 1q+, we leveraged external and in-house dependency screens and drug screens, along with single-cell sequencing of patient tumors with subclonal 1q+. We demonstrated that MM with 1q+ exhibits higher sensitivity to MCL1 and PI3K inhibitors, which may be synergistic and act through established and novel mechanisms. Two human MM cell lines with 1q+, KMS12BM and KMS11, were profiled with either single-cell RNA-sequencing (scRNA-seq) alone (KMS12BM, KMS11) or both scRNA-seq and whole-genome sequencing (WGS; KMS12BM) to understand the factors that determine response to MCL1 and PI3K inhibitors and how these inhibitors work.

  Study phs003886

• Genomics Analysis Reveals Molecular Patterns of Tumorigenesis in HPV-Associated and HPV-Independent Sinonasal Squamous Cell Carcinoma

  The goal of this study was to identify molecular mechanisms of tumorigenesis in HPV-associated and HPV-independent sinonasal carcinoma using high-throughput sequencing approaches. Whole genome sequencing was performed for HPV-associated samples and whole exome sequencing for HPV-independent samples. Ultimately, we identified distinct molecular patterns of tumorigenesis between HPV-associated and HPV-independent disease. Data from patients for which informed consent allowed public sharing are included here.

  Study phs003591

• A Phase I Study of the Treatment of Recurrent Malignant Glioma with CAN-3110 (AKA rQNestin34.5v.2), a Genetically Engineered HSV-1 Virus

  This study is a "first-in-human" phase 1 trial of recurrent, IDH wild-type glioblastoma (rGBM) patients treated with CAN-3110 (aka rQNestin34.5v.2), a genetically modified oncolytic herpes simplex virus 1 (HSV-1). The study was a 3+3 dose-escalation study starting at a single intra-tumoral injection of 106 PFU CAN-3110 going up to 1010 PFU in half-log increments (cohorts 1-9). An expansion cohort (cohort 10) was treated with 109 PFU injected into up to 5 sites within a single tumor. Principal findings of the study conclude that:CAN-3110 was safe at all tested doses (no dose-limiting toxicities reached)HSV-1 seropositive patients survived significantly longer than HSV-1 seronegative patients in this study - longer than expected based on historical rGBM controlsHSV-1 seropositive patients were significantly more likely to clear CAN-3110 (HSV-1) antigen from their tumors based on immunohistochemical stainingCAN-3110 treatment-induced CD8+/CD4+ T-cell recruitment to injected tumor sites altered TCR beta diversity in both tumor infiltrating leukocytes (TILs) and PBMCs, and initiated changes in specific TCR beta clonotypes and immune gene signatures which were associated with post-treatment survival.Data provided in dbGaP for this study include:Bulk RNA-Seq data for 13 pre/post-treatment pairs of rGBM tumors corresponding to 12 unique patients (patient 28 was treated with CAN-3110 at two different timepoints). This data is provided as raw sequencing reads (.fastq), kallisto pseudoalignment transcript-level read counts (abundance.tsv files), gene-level abundance matrix (Gene_Level_Expression_Matrix.tsv), and immune gene signature scores matrix (Immune_Gene_Signatures_Matrix.tsv). Sequencing was performed as paired 150bp sequencing on NovaSeq6000 S4 Illumina flow cells. Library preparation varied by batch as described in the included RNAseq_Metadata.xlsx table.TCR beta DNA sequencing performed by Adaptive Biotechnologies for 21 pre/post-treatment pairs of rGBM tumors and PBMCs representing 20 unique patients (patient 28 was treated with CAN-3110 at two different timepoints). Note that all tumor pairs with TCR beta sequencing data also have available bulk RNA-Seq data. The TCR beta sequencing data is provided as an excel spreadsheet (TCRbeta_Sample_Overview.xslx), which provides a broad level summary of the sequencing on a per-sample basis (# of TCRbeta templates, T cell fraction, TCR beta diversity metrics, etc.) and as a large tab separated value file (Full_TCRbeta_Rearrangement_Details.tsv), which provides information per sample at the level of each unique TCR beta sequence (amino/nucleic acid sequence, VDJ gene usage, etc.).An excel table of de-identified metadata for the patients involved in this study.

  Study phs003378

• Integrated Somatic and Germline Molecular Properties Dictating Biological and Clinical Phenotypes in Cancer

  We performed single-nuclei matched RNA- and ATAC-sequencing of frozen biopsies from normal adjacent tissue, primary and metastatic esophageal adenocarcinoma specimens. The data was then further stratified into a tumor microenvironment and malignant compartment and was computationally analyzed to reveal cancer cell subtypes and programs driving malignancy.

  Study phs003438

• Addiction of Primary Cutaneous Gamma-Delta T-cell Lymphomas to JAK-STAT Signaling

  Primary cutaneous γδ T-cell lymphoma (PCGDTL) is a mature T-cell lymphoma (TCL) of the skin with a median survival of 31 months and no effective therapies. PCGDTLs frequently possess mutations in the JAK/STAT pathway, including in JAK1, JAK3, STAT3, STAT5B, and SOCS1. We hypothesized that single-agent JAK inhibition may be effective in PCGDTLs, particularly those with targetable JAK/STAT pathway mutations. Herein, we demonstrate the near-complete response of two PCGDTL cases to single-agent JAK inhibitors, ruxolitinib or cerdulatinib. However, both patients eventually relapsed with acquired mutations in JAK1, JAK3, or STAT5B.

  Study phs003837

• Immune-Related Adverse Events after Immune Checkpoint Blockade-Based Therapy are Associated with Improved Survival in Advanced Sarcoma

  Immune activation after immune checkpoint blockade (ICB) can lead to a unique group of adverse events (AEs), which have been associated with improved outcome in many carcinomas. The association between immune-related AEs (irAEs) and outcome in patients with sarcoma is not well studied. This study has two components: (1) a retrospective clinical study of irAEs among 131 patients treated with ICB at Memorial Sloan Kettering Cancer Center and (2) an analysis of a subset of these patients who have whole transcriptome sequencing available for analysis. In the clinical study portion, we reviewed a cohort of patients with advanced sarcoma treated on prospective clinical trials utilizing ICB-based therapy between April 2017 and January 2020. The objectives were to pool the safety data from each trial, identify irAEs, and correlate them with best overall response by RECIST 1.1, progression-free survival (PFS) and overall survival (OS). Association of irAEs with response and survival was assessed using a Cox regression model. A total of 131 patients were included. Forty-two (32%) had at least one irAE of any grade and 16 (12%) had at least one Grade ≥ 3 irAE. On Cox analysis adjusting for clinical covariates that were significant in the univariate setting, the hazard ratio (HR) for an irAE (HR 0.662, 95% CI 0.421 - 1.041) approached, but did not reach statistical significance for PFS (P = 0.074), while patients had a significantly lower HR for OS (HR 0.443, 95% CI 0.246 – 0.798; P = 0.007) compared to those without or before an irAE. Tumor samples with available RNA sequencing data were stratified by presence of an irAE to identify patterns of differential gene expression. In total, 71 unique patients had RNA sequencing available for analysis. The transcriptomes of 31 of these patients have been previously uploaded to dbGaP (phs002852), leaving 36 unique transcriptomes that have not been previously publicly shared. Three patients did not agree for their sequencing to be publicly shared. Therefore, 33 unique patient samples will be uploaded to this dbGaP study. Overall, this study found that gene expression profiling on baseline tumor samples from patients who had an irAE had higher numbers of tumor-infiltrating dendritic cells, CD8+ T cells, and regulatory T cells as well as upregulation of immune and inflammatory pathways.

  Study phs003284

• Multi-Omic Investigation of Beckwith-Wiedemann Syndrome Hepatoblastoma

  Hepatoblastoma (HB) is the most common malignant liver tumor diagnosed in children under 5 years of age. One of the most common HB predisposition syndromes is Beckwith-Wiedemann Syndrome (BWS, OMIM 130650), which affects approximately 1/10,000 live births. In this study, we perform Whole Exome Sequencing (WES), DNA methylation array, messenger RNA-Sequencing (mRNA-Seq), and microRNA-Sequencing (miRNA-Seq) to examine the genomic, methylomic, and transcriptomic signature of BWS HB. We analyzed five tumor-normal paired samples, two BWS tumor only samples, and five non-BWS control samples to identify a predisposition and oncogenic signature of BWS HB development. To further understand the new impact of 11p15 changes, specifically in the liver, we performed single-nucleus RNA sequencing (snRNA-seq) and single-nucleus assay for transposase-accessible chromatin with sequencing (snATAC-seq) to generate paired, cell-type-specific transcriptional and chromatin accessibility profiles of both BWS-liver and nonBWS-liver nontumorous and tumor tissues.

  Study phs002614

• DAC_RNA-seq of murine osteosarcoma cell line genetically modified for CYR61

  Data access committee for RNA-seq of murine osteosarcoma cell line genetically modified for CYR61

  Dac EGAC50000000352

• "IL-17A-Producing ILC3s and Duodenal Adenoma in FAP"

  Dac EGAC00001003301