5250 results for "*oma"

in 17.33 milliseconds.

• Yale SPORE in Skin Cancer Project 2

  Understanding the relationship between tumor and peripheral immune environments could allow longitudinal immune monitoring in cancer. Here, we examined whether T cells that share the same TCRab and are found in both tumor and blood can be interrogated to gain insight into the ongoing tumor T cell response. Paired transcriptome and TCRab repertoire of circulating and tumor-infiltrating T cells were analyzed at the single cell level from matched tumor and blood from patients with metastatic melanoma. The data shared here consist of gene expression matrix and fastq files obtained from sequencing single-cell libraries generated with the Chromium (TM) 5' technique. For each of 18 immunotherapy naive and 11 previously treated melanoma patients, T cells (Live/CD45+/TcRab+) were FACS-sorted from PBMCs and freshly resected tumors. Metadata associated with each individual cell consist of Patient I.D., biological sex, immunotherapy status, amino acid and nucleotide CDR3 sequence of the TCR alpha and beta chain (obtained from matched VDJ region enriched libraries), and sequencing batch. Further details about previous treatment history and other clinical parameters can be found in the associated manuscripts (Lucca et al., 2021: PMID: 33651881; Lu et al., PMID: 39609626).

  Study phs002289

• Melanoma Genome Sequencing Project

  Melanoma is the most prevalent cause of skin cancer morbidity and mortality. In order to characterize the full range of somatic mutations that may drive the growth of melanoma, we are sequencing tumor and normal DNA from a set of roughly 150 melanomas. For the majority of samples (approximately 90% of the cases), mutations in protein coding genes will be assessed in the exonic DNA of tumor-normal pairs using hybrid capture and paired-end DNA sequencing. For a few of DNA samples (approximately 10% of the cases), the entire genomes will be analyzed to assess the possible contribution of complex structural rearrangements contributing to oncogenesis. The sequencing data are supplemented by copy number profiling on the same tumors using high-density SNP arrays. Integration of these approaches will enable the unbiased and comprehensive characterization of both known and novel recurrent DNA alterations that arise in melanoma.Versions 1-4 contain whole exome and bulk RNA sequencing data for patients with melanoma.Version 5 - We compared somatic genomic profiles from matched pre-treatment and post-resistance tumor biopsies in patients with metastatic melanoma who exhibited heterogeneous responses to immune checkpoint inhibitors (ICIs). This version includes whole exome sequencing (WES) data from 14 patients.

  Study phs000452

• Identification of Novel Immunotherapy Targets in Myeloma

  RNA sequencing (RNA-Seq) was performed on 94 multiple myeloma (MM) patient samples. We used genomic subgroup and high-risk markers to identify therapeutic targets, including TNFRSF17, GPRC5D, ITGA4, and LAX1, with low predicted toxicity and high specificity to MM and genomic subgroups such as those with TP53 alterations.

  Study phs003772

• MDACC Lymphoma & Myeloma WGS of Tumor and Non-tumor Cells in Multiple Myeloma

  FastQ files from paired tumor and non-tumor WGS data from patients diagnosed with newly diagnosed (n = 6), refractory/relapsed multiple myeloma (n = 3) or plasma cell leukemia (n = 1). These samples presented >95% tumor PCs in bone marrow aspirates. Plasma cells and T cells (non-tumor cells) were isolated from bone marrow aspirates using a magnetic approach.

  Dac EGAC50000000282

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• MDACC Lymphoma & Myeloma scRNAseq of Plasma Cells in Multiple Myeloma

  FastQ files from Chromium single cell 5' gene expression and B-cell receptor sequencing of plasma cells from patients diagnosed with a monoclonal gammopathy of the multiple myeloma spectrum, including the precursor stages MGUS (n =13) and SMM (n = 22); newly diagnosed (n = 17); relapsed (n = 15); and plasma cell leukemia (n = 2); and 3 controls.

  Dac EGAC50000000271

• International Cancer Proteogenome Consortium (ICPC): Proteogenomics of Oral Squamous Cell Carcinoma in Taiwan

  Oral cavity squamous cell carcinoma (OSCC) is the major subtype (~90%) of oral cancer, which is leading cancer with high mortality worldwide. The environmental risk factors associated with OSCC are quite different in Taiwan as compared to other populations. In most non-Taiwanese populations, OSCC is often associated with tobacco chewing, cigarette smoking, alcohol drinking, or human papillomavirus (HPV) infection. In Taiwan, in contrast, the OSCC occurs mainly in males aged 30 years or older who have habitual betel nut chewing, cigarette smoking, and alcohol drinking. To uncover molecular mechanisms and identify new therapeutic strategies of oral squamous cell carcinoma, this study recruited 112 treatment-naïve OSCC patients and generated multi-omics data, including WES, RNA-Seq, TMT-labeled proteomes, and phosphoproteomes from paired normal/tumor tissues. We have investigated our multi-omics data, covering molecular characterizations such as mutation signatures, impacts of mutations on RNA/protein/phosphoprotein, RNA-protein correlation, somatic copy number alteration, and the relationship with RNA & protein, proteome, and phosphoproteome analysis (T vs NAT), novel peptides (somatic variants, neoantigens, CT antigens, T cell receptors, etc.), as well as molecular subtyping (& pathway analysis). Notably, we have discovered a higher frequency of APOBEC3B deletion polymorphism in the Taiwanese population, and APOBEC3A is a potential prognostic biomarker. Our proteogenomic data enable us to further stratify patients into four groups based on APOBE3A expression level, which is found inversely correlated with EGFR expression. Therefore, the patients with high EGFR and low APOBEC3A expression may benefit from anti-EGFR therapy, while those with low EGFR and high APOBEC3A expression may benefit from immunotherapy. To clarify if there is an interaction between genetic polymorphisms and betel nut chewing habit in Taiwanese OSCC, we plan to concurrently evaluate the effect of habitual betel nut chewing on the gene mutation pattern, the dysregulated protein/phosphoproteins as novel biomarkers and/or therapeutic targets, and the molecular subtyping of patients for effective treatments. 

  Study phs002580

• Childhood Cancer Data Initiative (CCDI): Pediatric In Vivo Testing Program - Neuroblastoma

  The goal of NCI's Pediatric In Vivo Testing Consortium (PIVOT) is to advance the development of effective treatments for pediatric cancers through preclinical in vivo testing of novel therapeutic agents. To design impactful experiments that can be rapidly translated to the clinic, PIVOT investigators require comprehensive genomic characterization of the patient-derived xenograft (PDX) models used across the consortium. This robust experimental design enhances collaboration with industry partners by providing proof-of-concept data for drugs in development. As part of this effort, neuroblastoma PDX models are being molecularly characterized to identify promising therapeutic candidates. The molecular profiling includes whole exome sequencing (WES), RNA-seq, MethylEPIC array, CytoSNP array, and DNA fingerprinting for quality control. Additionally, demographic and clinical data (e.g., diagnosis, disease site, disease status) are shared. These characterized PDX models, matched with patient tumors, guide model selection for preclinical drug testing.

  Study phs003163

• TIGER-LC High-Throughput Sequencing

  Intrahepatic cholangiocarcinoma (CCA) and hepatocellular carcinoma (HCC) are clinically disparate primary liver cancers with etiological and biological heterogeneity. We performed sequencing on multiple data levels of Thai CCA and HCC among the Thailand Initiative in Genomics and Expression Research for Liver Cancer (TIGER-LC) cohort using targeted OncoVar platform, whole exome, whole transcriptome, and whole genome metagenomic sequencing.

  Study phs001199

• A Clone's Genomic Stability as a Biomarker of Its DNA-Damage Resilience

  A main problem in the treatment of advanced cancers, including gastric cancers and glioblastoma, is the incertitude at which we predict how individual patients will respond to DNA-damaging agents, especially on the long run. Knowing the mechanism behind a patient's response, or the lack thereof, will help us depart from the oversimplified “more-is-better” and “one-size-fits-all” principles according to which DNA-damaging agents are administered. This will improve clinical outcome by allowing us to pinpoint those who would respond better and longer to lower doses than to higher doses of DNA-damaging agents. Under the assumption that the success of DNA-damaging therapy increases with the proliferation rate of a relatively homogeneous tumor population, there was little reason to assume anything other than monotonic dose-response relations. With the recent paradigm shift that most cancers are in fact DNA mosaic products of ongoing evolution, comes the urgency to reconsider these fundamental principles behind DNA-damaging therapy administration. As the developers of one of the first DNA deconvolution methods and with access to technologies to profile the transcriptomes of up to 10,000 cells simultaneously, we are equipped to embark on first personalized dose-finding strategies for DNA-damaging therapies. We will test the potential of the very long-term legacy that DNA-damage entails on a cell “genomic instability” as new biomarker of DNA-damage response. Our preliminary studies showed that, for most cancer types, DNA-damaging agents change a clone's genomic instability and that clones succumb to a limit in the amount of genomic instability they can tolerate. In particular, our results showed that patients with intermediate genomic instability have a very poor outcome and that this relation is only evident among treatment-naive patients, but not among patients treated with DNA-damaging agents. Further they show that we can measure genomic instability per clone and that clones with extreme genomic instability typically don't grow large. Our hypothesis that genomic instability, rather than proliferation rate, determines how sensitive a tumor is to DNA-damaging agents on the long-term, is founded on two unexpected findings. Patients with extremely high genomic instability per tumor clone have an exceptionally good outcome. Aim 1 will integrate exome- and single cell RNA-Seq (scRNA-Seq) data to characterize clones and to measure how much genomic instability they can tolerate. Low genomic instability is associated with reduced benefit from DNA-damaging agents. Aim 2 will use comet assays and treatment history to quantify DNA damage per clone, relating it to the clones' ability to tolerate DNA damage and to changes in the genomic instability of therapy-surviving clones.

  Study phs003762