10713 results for "800k fc coins Navštivte Buyfc26coins.com Speciální balíčky na prázdniny a dovolené..dQVy"

in 10.38 milliseconds.

• Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Dataset EGAD00001000002

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• WTCCC2 Pre-eclampsia Study

  A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.

  Study EGAS00001003349

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  Dataset EGAD00001006877