4738 results for "RNA AND sequencing OR transcriptome"

in 15.60 milliseconds.

• The Role of E2F4 in Controlling Resistance to Irinotecan (CPT-11) in Human Colon Cancer

  This study reports the results of RNA sequencing (RNA-seq) experiments performed on three isogenic clones of the human HT29 colon cancer cell line, genetically engineered to achieve the selective inactivation of the adenovirus early 2 (E2) gene transcription factor 4 (E2F4) protein, a key functional component of the multimeric transcriptional repression complex known as the dimerization partner (DP), retinoblastoma-like (RB-like), E2F and multi-vulva class B (MuvB) complex (DREAM). In previous studies, we identified E2F4 as a key regulator of colorectal cancer (CRC) resistance to irinotecan (CPT-11), a cytotoxic agent that stands at the backbone of multiple chemotherapy regimens for the treatment of metastatic CRCs. The molecular mechanisms linking E2F4 to irinotecan resistance, however, remain poorly understood. The present study was designed to identify which genes are under the transcriptional control of E2F4, either at baseline or following exposure to SN38 (i.e., the active metabolite of irinotecan, generated in vivo by biotransformation in the liver) in order to clarify the role played by E2F4 in shaping colon cancer resistance to chemotherapy. The cell line used for this study (HT29) is aneuploid and contains three copies of the E2F4 gene, because of a trisomy of chromosome 16, where the E2F4 gene is located (Kawai et al., Genes, Chromosomes & Cancer, 34:1-8, 2002; PMID: 11921276). HT29 cells were infected with lentivirus vectors encoding for CRISPR/Cas9 constructs designed to selectively inactivate the E2F4 gene, using three distinct guide-RNAs (gRNAs), each targeting a different sequence within the proximal exons of the E2F4 gene (exon 1, exon 2). Lentivirus-infected cells were sub-cloned by single-cell fluorescence-activated cell sorting (FACS), based on the differential expression of a fluorescent reporter (EGFP) expressed in tandem with the gRNAs. Isogenic clones (EGFP+) were then screened to identify those with a tri-allelic knock-out, as revealed by both genetic sequencing of the E2F4 gene (revealing the presence of three distinct frameshift mutations) and Western blot (revealing complete loss of E2F4 protein expression). The study includes twelve (n=12) RNA-seq experiments, representative of 3 experimental replicates (i.e., three distinct isogenic clones of the HT29 cell line, each displaying complete loss of E2F4 expression) and 3 negative controls (i.e., three independent preparations of the parent HT29 cell line, infected with a lentivirus vector encoding for a non-targeting gRNA) exposed to 2 distinct in vitro cell culture conditions: a) treatment with SN38 resuspended in dimethyl sulfoxide (DMSO); or b) treatment with DMSO alone (negative control). The in vitro treatment regimen used for SN38 (32 nM, 24 hours) was designed so that the exposure to SN38 experienced in vitro by HT29 cells would mirror the exposure to SN38 experienced in vivo by malignant tissues, as measured, for example, in metastatic CRC patients receiving a standard dose of irinotecan (180 mg/m2) administered by intravenous infusion over 90 minutes (Deyme et al., Cancer Chemotherapy and Pharmacology, 88:247-258, 2021; PMID: 33912999).

  Study phs003560

• Comprehensive gene analysis of colorectal cancer cases

  Colorectal cancer is the third most common morbidity and the fourth leading cause of cancer death in the world.To characterize the mutation profiles of colorectal cancer with liver metastasis,we performed both whole-exosome sequencing and RNA sequencing for 12 cases of colorectal cancer with liver metastasis (group A) and 16 cases of colorectal cancer without liver metastasis (group B). As a result of driver mutation search by Mutsig pipeline, PTEN was identified as a significant mutant gene in group A alone.ADAMTS10,NELL1 and RXFP3 were identified as candidate genes for metastasis by MuTect,SID and VarScan pipeline.Furthermore, in all samples, the copy number of chromosomes 1p,4,7,8,13,15, 17p,18,20 and 22q were significantly abnormal. Chromosomes 1p,4,15,18,17p,22q were deleted and chromosomes 7, 8,13 and 20 were amplified by CNV.Pathway analysed revealed Wnt/Ca2+ and PCP pathway was involved in metastasis of cl cancer.9 kinds of fusion genes were identified in deFuse pipeline. Among them, ADAP1 fusion genes were identified in 2 samples, and ADAP1 fusion genes were further identified in 3 samples by our in-house algorithm. It is suggested that new fusion genes present in such multiple samples may be involved in the development of colorectal cancer.

  Study JGAS000128

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• Clinical phenotype data

  Clinical data corresponding to the patients with ovarian cancer studied using scRNA-seq and bulk RNA-seq. Variables include molecular subtype, predicted immune phenotype, reviewing pathologist comment, final immune phenotype, histology characterization, and tumor stage.

  Dataset EGAD00001006973

• PsychENCODE Consortium: Epigenetic and Transcriptional Dysregulation in Autism Spectrum

  Our current understanding of autism spectrum disorders (ASD) delineates a highly heritable, yet etiologically heterogeneous disease. Forward genetic approaches to find disease associated mutations or common variation have been successful and continue to offer considerable power. Yet, given the accumulating evidence for very significant heterogeneity and environmental influences, complementary approaches to classic forward genetics become necessary. Genetic polymorphism and mutation data to date have identified dozens of causal or contributory variants, yet our preliminary data from autism brain suggest that common molecular pathways are involved in a significant subset of cases. This convergence at the tissue level suggests that other mechanisms, specifically epigenetic changes, combined with genetic background, are contributing to such final common pathways. We further tested this hypothesis by taking a comprehensive and integrative genome-wide approach to assessing brain gene-expression, miRNA levels and the related, causal epigenetic mechanisms in ASD etiology. We performed RNA-seq analyses of four cerebral cortical regions and cerebellum from ASD cases and controls, to assess mRNA, miRNA, and splicing isoform regulation. In parallel, we identified key differences in chromatin state and DNA methylation across multiple brain regions in the same ASD and control individuals used in the expression analyses using ChIP-Seq and MeDIP. We assessed the mechanisms by which changes in DNA methylation, histone modification, and DNA sequence contribute to the observed differences in gene expression. This work, which represents an unprecedented effort to unify these often disparate data (usually produced without integration in mind), delineates potential shared molecular pathways in ASD and the underlying mechanism of these differences at the level of miRNA, the chromatin regulatory apparatus, and DNA methylation. The following substudies are part of the PsychENCODE release at dbGaP and offer additional molecular data: PsychENCODE: RNA-Sequencing - SRRM4 Splicing Study phs000872 PsychENCODE: Global Changes in Patterning, Splicing and lncRNAs phs001061 PsychENCODE: Chromatin Contact Map in Fetal Cortical Laminae phs001190 PsychENCODE: Epigenetic Dysregulation in Autism Spectrum Disorder phs001220

  Study phs001022

• CDK4/6 inhibition in advanced chordoma: final results of the NCT PMO-1601

  Background. Chordoma is a rare bone tumor with no approved systemic therapy. Inactivation of the tumor suppressor p16 (encoded by CDKN2A) leads to aberrant cyclin D-CDK4/6-RB pathway activity, which can be inhibited by palbociclib in chordoma cell lines. Patients and Methods. We conducted a phase II single-arm, open-labeled trial on palbociclib in adult patients with advanced chordomas with p16 loss (by immunohistochemistry) or CDKN2A loss (by genomic analysis) and CDK4/6 and RB1 presence (by immunohistochemistry or RNA-Sequencing). Patients received 125mg palbociclib once daily for 21 days in a 28-day cycle. The study used a Simon optimal 2-stage design. The primary endpoint was disease control rate after six cycles. Response was evaluated according to Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1. Secondary endpoints included progression-free survival, overall survival, and biomarker analysis. The study was considered positive if 25% of patients reached the primary endpoint. Results. Between December 2017 and April 2023, 28 patients (median age 60 years, range 31-84) were enrolled. After a median follow-up of 28 months, the disease control rate was 39%, with 11 out of 28 patients achieving stable disease. No objective responses were observed. The median progression-free survival was 5.6 months, and the median overall survival was 24.6 months. Treatment was well tolerated without new safety signals. CDKN2A deletions were the most common genomic alterations underlying p16 loss and were accompanied by MTAP co-deletion. There was no correlation between responder phenotypes by immunohistochemistry and outcome. RNA-based analysis showed heterogeneous pathways deregulation at study entry suggesting underlying primary resistance mechanisms Conclusion. This trial met its primary endpoint with a 39% disease control rate, though antitumor activity was modest. Molecularly tailored combination therapies should be considered to improve efficacy. (ClinicalTrials.gov number, NCT03110744).

  Study EGAS00001007985

• Epigenomes and Transcriptomes of Brain Samples of Schizophrenics and Controls

  We examined the effects of antipsychotic medications on the cell-specific epigenomics and transcriptomics in the frontal cortex of schizophrenic subjects. We performed ChIP-seq (H3K4me3 and H3K27ac) and RNA-seq on neuronal and non-neuronal nuclei of postmortem frontal cortex samples from two cohorts of schizophrenics, either previously treated or not with antipsychotic medications, and control subjects individually matched by sex and age. In total, we tested 29 schizophrenics (15 untreated and 14 treated patients) and their matched control samples. Two replicates were produced on each brain sample for each assay. ChIP-seq data were generated using MOWChIP-seq (Zhu et al., PMID: 31666743) and RNA-seq data were produced using the combination of SMART-seq2 (Picelli et al., PMID: 24385147) and a Nextera XT DNA library preparation kit. The filename contains the information on the experimental group, the number of the sample within the group, the type of the brain nuclei, the epigenomic/transcriptomic data set (either H3K27ac or mRNA), and the number of replicate. For example, “SCZ-1-untreated-neuron-H3K4me3-R1” refers untreated schizophrenic sample #1, replicate 1 ChIP-seq data on H3K4me3.

  Study phs002487

• Experimental PfSPZ Vaccine in Adults Without Malaria

  The study was performed to evaluate whole-blood transcriptomic profiles via RNA-seq before, during, and after immunization with the PfSPZ Vaccine in malaria-naïve, healthy adults enrolled in VRC 312 (NCT01441167). VRC 312 was the second study of the PfSPZ Vaccine and the first study to evaluate intravenous (IV) administration of this vaccine. The study was an open-label evaluation of the safety, tolerability, immunogenicity, and protective efficacy of the vaccine at successively higher administered by the IV route. The highest dosages were evaluated for protection against a malaria challenge after 4 to 6 vaccinations. The primary objectives of the study were related to the safety and tolerability of the vaccine at the 4 different dosage levels when administered IV; the secondary objectives were related to PfSPZ vaccine-mediated protection against Plasmodium falciparum (Pf) challenge at the 3 higher dosage levels, and the exploratory objectives were related to the immunogenicity of the PfSPZ Vaccine and defining an immune correlate of protection. To further determine potential molecular correlates of immunogenicity and/or protection, RNA-seq was performed on whole blood collected from subjects in all dose groups at time points before, during, and after immunization.

  Study phs002422

• Cholesterol and Pharmacogenetics (CAP) Study

  The Cholesterol and Pharmacogenetics Study was a 6-week open label, non-randomized study of 40mg/day simvastatin treatment in 335 black and 609 white (944 total) men and women. Plasma lipids and lipoproteins were measured on two occasions prior to treatment and at 4 and 6 weeks of treatment. The study was designed to test for genetic associations with baseline measurements and changes in response to simvastatin treatment. Whole genome genotyping was performed on 592 white CAP study participants in two stages. In Stage 1, 304 were genotyped for 314,621 SNPs to tag for common genomic variation. In Stage 2, 290 participants were genotyped, including 280 who were genotyped for 620,901 SNPs. Two samples were excluded due to gender discrepancies. More recently, CAP self-reported black participants were genotyped on Illumina Omni2.5Exome chips. PolyA-selected strand-specific RNA-seq libraries were generated in several batches from lymphoblastoid cell lines (LCLs) derived from 268 white and 165 black CAP participants. The LCLs were exposed to sham buffer (control) or 2 uM activated simvastatin for 24 hours, producing a total of 866 100/101 bp paired end RNA-seq libraries sequenced on Illumina HiSeq 2000 machines.

  Study phs000481