12024 results for "division 2 coins fc 26 Visit Buyfc26coins.com Kupiłem(a) duży pakiet monet FC 26 i dostałem(a) dodatkowy rabat. Świetnie!.fXzt"

in 16.76 milliseconds.

• Identifying transcriptional programs underlying anti-EGFR small molecule response and resistance with TraCe-seq

  Genetic and non-genetic heterogeneity within cancer cell populations represents a major challenge to anti-cancer therapies. We currently lack robust methods to determine how pre-existing and adaptive features affect cellular responses to therapies. Here, by conducting clonal fitness mapping and transcriptional characterization using expressed barcodes and single-cell RNA-sequencing, we have developed TraCe-seq, a method that captures at clonal resolution the origin, fate, and differential early adaptive transcriptional programs of cells in a complex population in response to distinct treatments. We used TraCe-seq to benchmark how next-generation dual EGFR inhibitors-degraders compare to standard EGFR kinase inhibitors in EGFR-mutant lung cancer cells. To QC the TraCe-seq strategy, single-cell RNA-seq libraries were generated from a variety of human cancer cell lines transduced with the TraCe-seq library to validate the TraCe-seq strategy. Specifically, 5 different cell lines (PC9, MCF-10A, MDA-MB-231, NCI-H358, and NCI-H1373) were each transduced with a unique TraCe-seq barcode. The transduced cells were selected with puromycin only, dissociated to single cell suspensions, and then mixed together. The complex mixture of the 5 cell lines was profiled by 10X scRNA-seq. Furthermore, transduced NCI-H1373 cells were sorted by FACS to enrich for the top 50% of eGFP positive cells, and sorted cells were cultured briefly and used to construct scRNA-seq libraries and profiled by 10x scRNA-seq. To carry out the full TraCe-seq experiment, ~600 PC9 cells carrying unique TraCe-seq barcodes were expanded over 12 doublings to establish the barcoded population. A subset of the barcoded PC9 population was used to generate scRNA-seq libraries and profiled by 10x scRNA-seq prior to treatment to establish a baseline transcription profile for each barcoded clone. The rest of the cells were then treated for four days with 1 µM erlotinib, 1 µM GNE-069, or 1 µM GNE-104 respectively. scRNA-seq libraries were then generated form the treated cells and profiled by 10x scRNA-seq.

  Study EGAS00001005405

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Dataset EGAD00001000002

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• WTCCC2 Pre-eclampsia Study

  A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.

  Study EGAS00001003349

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963