21130 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins The service is affordable and quick..JIZq"

in 26.96 milliseconds.

• CHILD Study Dataset

  This data set contains the CRAM files for the samples in the CHILD cohort, sequenced on the Illumina HiSeq X platform.

  Dataset EGAD00001009710

• RNA-seq of granulosa cells from 8 IVF patients in two age groups

  This dataset contains raw sequencing data of mRNA from granulosa cell samples from 8 human patients undergoing in vitro fertilization. All patients were normal responders referred for male infertility and were grouped into two age groups (younger than 31 or older than 38 years old). Each sample contains all granulosa cells collected from one patient on one collection date. Raw sequencing fastq files are available in this dataset, count tables are available in ArrayExpress (E-MTAB-13496).

  Dataset EGAD50000001210

• Sequencing data for oesophageal and related samples - BOs release 4 (RNA)

  Dataset EGAD00001004023

• Sequencing data for oesophageal and related samples - Mourikis et al (WGS)

  Data supporting: "Patient-specific detection of cancer genes reveals recurrently perturbed processes in esophageal adenocarcinoma." Mourikis et al. WGS (BAM files) 521 samples

  Dataset EGAD00001004775

• RNA of peripheral blood for pancreatic cancer and chronic pancreatitis

  Samples of nucleated cells found in peripheral blood from over 300 patients suffering from resectable pancreatic ductal adenocarcinoma, non-resectable pancreatic cancer, chronic pancreatitis, or none of these. Please cite this article when using data: Al-Fatlawi, A.; Malekian, N.; García, S.; Henschel, A.; Kim, I.; Dahl, A.; Jahnke, B.; Bailey, P.; Bolz, S.N.; Poetsch, A.R.; Mahler, S.; Grützmann, R.; Pilarsky, C.; Schroeder, M. Deep Learning Improves Pancreatic Cancer Diagnosis Using RNA-Based Variants. Cancers 2021, 13, 2654. https://doi.org/10.3390/cancers13112654

  Dataset EGAD00001006915

• Dataset for COPD human sputum 16S rRNA gene sequencing data

  Dataset for 16S rRNA gene sequencing data for sputum samples 61 COPD patients, generated using PacBio sequencing technology.

  Dataset EGAD00001009103

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764