10859 results for "fc 26 coins u7buy Visit Buyfc26coins.com Megkaptam az FC 26 érméket a garantált idő előtt. Mindig bonuszként!.HNTf"

in 12.41 milliseconds.

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Dataset EGAD00001000002

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• WTCCC2 Pre-eclampsia Study

  A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.

  Study EGAS00001003349

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• WGS and RNA-Seq data from a GBM patient PT-DF5919

  WGS and RNA-Seq data from a GBM patient PT-DF5919

  Dataset EGAD00001004232

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• WGS and RNA-Seq data from a GBM patient PT-AL4257

  WGS and RNA-Seq data from a GBM patient PT-AL4257

  Dataset EGAD00001004225

• RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  Dataset EGAD00001006877

• WGS and RNA-Seq data from a GBM patient PT-AR5365

  WGS and RNA-Seq data from a GBM patient PT-AR5365

  Dataset EGAD00001004227

• WGS and RNA-Seq data from a GBM patient PT-RW9277

  WGS and RNA-Seq data from a GBM patient PT-RW9277

  Dataset EGAD00001004259

• Genome and transcriptome sequence data from a diffuse aarge B-cell lymphoma (relapse) tumor patient

  Genome and transcriptome sequence data from a diffuse large B-cell lymphoma (relapse) patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015308

• Genome and transcriptome sequence data from a relapsed blastic plasmacytoid dendritic cell neoplasm tumor patient

  Genome and transcriptome sequence data from a relapsed blastic plasmacytoid dendritic cell neoplasm patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015312

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Genome and transcriptome sequence data from a metastatic malignant peripheral nerve sheath tumor tumor patient

  Genome and transcriptome sequence data from a metastatic malignant peripheral nerve sheath tumor patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015322

• Genome and transcriptome sequence data from a CNS non-germinoma germ cell tumour tumor patient

  Genome and transcriptome sequence data from a CNS non-germinoma germ cell tumour patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015327

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Germ Cell and Associated Heme Malignancies Evolve from a Common Shared Precursor

  Germ cell tumors (GCTs) are the most common cancer in men between the ages of 15-40. While most patients are cured, those with disease arising in the mediastinum have distinctly poor outcomes. One in every 17 patients with primary mediastinal non-seminomatous GCTs develop an incurable hematologic malignancy and prior data intriguingly suggests a clonal relationship exists between hematologic malignancies and GCTs in these cases. To date however, the precise clonal relationship between GCTs and the diverse additional somatic malignancies arising in such individuals has not been determined. Here, we traced the clonal evolution and characterized the genetic features of each neoplasm from a cohort of fifteen patients with GCTs and associated hematologic malignancies. We discovered that GCTs and hematologic malignancies developing in such individuals evolved from a common shared precursor, nearly all of which harbored allelically imbalanced TP53 and/or RAS pathway mutations. Hematologic malignancies arising in this setting genetically resembled mediastinal GCTs rather than de novo myeloid neoplasms. Our findings argue that this scenario represents a unique clinical syndrome, distinct from de novo GCTs or hematologic malignancies, initiated by an ancestral precursor which gives rise to the parallel evolution of GCTs and blood cancers in these patients. Reprinted from PMID: 32897884, with permission from JCI.

  Study phs002231

• A Large Data Resource of Genomic Copy Number Variation across Neurodevelopmental Disorders

  This study presents the first genome-wide copy number variation (CNV) analysis across autism spectrum disorder (ASD), attention deficit hyperactivity disorder (ADHD), schizophrenia (SCZ), and obsessive-compulsive disorder (OCD). A total of 2,691 subjects diagnosed with a neurodevelopmental disorder (NDD), and a total of 1,769 unaffected family members from Ontario, Canada were assayed using the Affymetrix CytoScan HD array. We identified rare CNVs, (< 0.1% frequency in 10,851 population control samples), and found clinically relevant CNVs in 10.5% of total subjects. Among all NDD subjects, we identified 17 (0.63%) with aneuploidies and 115 (4.3%) with known genomic disorder variants. We searched further for genes impacted by different CNVs in multiple disorders. Examples of NDD-associated genes linked across more than one disorder (listed in order of occurrence) are NRXN1, SEH1L, LDLRAD4, GNAL, GNG13, MKRN1, DCTN2, KNDC1, PCMTD2, KIF5A, SYNM, and long non-coding RNAs: AK127244, NRON, and PTCHD1-AS. We demonstrated that identical CNVs or genes could potentially contribute to the etiology of multiple NDDs. The CNVs identified will serve as a useful resource for both research and diagnostic laboratories for prioritization of variants and clinical interpretations.CNV data from this study are available through dbVar at https://www.ncbi.nlm.nih.gov/dbvar/studies/nstd173/.

  Study phs001881