10963 results for "fc 26 coins u7buy Visit Buyfc26coins.com Megkaptam az FC 26 érméket a garantált idő előtt. Mindig bonuszként!.HNTf"

in 28.50 milliseconds.

• ECM-free patient-derived organoids preserve diverse prostate cancer lineages and uncover in vitro-enriched cell types

  Patient-derived organoids (PDOs) hold promise for modeling various cancers, yet their application in prostate cancer (PCa) has been limited due to low culture success and the predominance of non-tumor-like cells. Using 164 PCa samples and optimizing culture conditions, we demonstrate that an extracellular matrix (ECM)-free culture method improves PDO take-rates, fostering cell populations with luminal and PCa-specific characteristics. Single-cell RNA sequencing (scRNA-seq) reveals that these ECM-free PDOs closely mirror their original tumors at the transcriptomic level and maintain a diverse array of tumor cell types, unlike traditional Matrigel-based cultures which predominantly yield benign-like cells. This study introduces a PCa PDO single-cell atlas, providing a valuable resource for advancing prostate cancer research.

  Study EGAS50000000807

• Loss-of-activity-mutation in the cardiac chloride-bicarbonate exchanger AE3 causes short QT syndrome

  Patients with short QT syndrome (SQTS) may present with syncope, ventricular fibrillation or sudden cardiac death. Six SQTS susceptibility genes, encoding cation channels, explain less than 25% of SQTS cases. Here we identify a missense mutation in the anion exchanger (AE3)-encoding SLC4A3 gene in two unrelated families with SQTS. The mutation causes reduced surface expression of AE3 and reduced membrane bicarbonate transport. Slc4a3 knockdown in zebrafish causes increased cardiac pHi, short QTc, and reduced systolic duration, which is rescued by wildtype but not mutated SLC4A3. Mechanistic analyses suggest that an increase in pHi and decrease in [Cl-]i shortened the action potential duration. However, other mechanisms may also play a role. Altered anion transport represents a mechanism for development of arrhythmia and may provide new therapeutic possibilities.

  Study EGAS00001002632

• Multiple migrations to the Philippines during the last 50,000 years

  A key link to understand human history in Island Southeast Asia is the Philippine archipelago and its poorly investigated genetic diversity. We collected and analyzed the most comprehensive set of population-genomic data for the Philippines, 1028 individuals covering 115 indigenous communities. We demonstrate that the Philippines were populated by at least five waves of human migration. The Cordillerans migrated into the Philippines prior to the arrival of rice agriculture, where some remain to be the least admixed East Asians carrying an ancestry shared by all Austronesian-speaking populations; thereby challenging an exclusive Out-of-Taiwan model of joint farming-language-people dispersal. Altogether, our findings portray Philippines as a crucial gateway, with a multilayered history, that ultimately changed the genetic landscape of the Asia-Pacific region.

  Study EGAS00001005083

• Germline SDHB-inactivating mutation in gastric spindle cell sarcoma (HIPO-021)

  Gastrointestinal stromal tumors (GISTs) are the most frequent mesenchymal tumors of the gastrointestinal tract. Inactivating mutations or epigenetic deregulation of succinate dehydrogenase complex (SDH) genes are considered defining features of a subset of GIST occurring in the stomach. Based on comprehensive molecular profiling and biochemical analysis within a precision oncology program, we identified hallmarks of SDH deficiency (germline SDHB-inactivating mutation accompanied by somatic loss of heterozygosity, lack of SDHB expression, global DNA hypermethylation, and elevated succinate/fumarate ratio) in a 40-year-old woman with undifferentiated gastric spindle cell sarcoma that did not meet the diagnostic criteria for other mesenchymal tumors of the stomach, including GIST. These data reveal that the loss of SDH function can be involved in the pathogenesis of non-GIST sarcoma of the gastrointestinal tract.

  Study EGAS00001004277

• Persistent Mutation Burden Drives Sustained Anti-Tumor Immune Responses

  Tumor mutation burden is an imperfect proxy of tumor foreignness and has therefore failed to consistently demonstrate clinical utility in predicting responses in the context of immunotherapy. We evaluated mutations in regions of the genome that are unlikely to undergo loss and discovered that clonal mutations in single-copy regions and those present in multiple copies per cell constitute a persistent tumor mutation burden (pTMB) that is linked with therapeutic response to immune checkpoint blockade. Persistent mutations were retained in the context of tumor evolution under selective pressure of immunotherapy and tumors with a high pTMB content were characterized by a more inflamed tumor microenvironment. pTMB imposes an evolutionary bottleneck that cancer cells cannot overcome and may thus drive sustained immunologic tumor control in the context of immunotherapy.

  Study EGAS00001006660

• The Iberian Roma genetic variant server

  The Roma are the most numerous ethnic minority in Europe. The Iberian Roma arrived in the Iberian Peninsula five centuries ago and still today, they keep a strong group identity. Demographic and cultural reasons lie behind a high rate of Mendelian disease often related to founder variants. We have analysed exome data from 119 Iberian Roma individuals collected from 2018 to 2020. A database of variant frequency has been implemented (IRPVS) and made available online. We have analysed the carrier rate of founder private alleles as well as pathogenic variants present in the general population. Significant enrichment in structural variants involving gene clusters related to keratinization and epidermal growth suggest that evolutive mechanisms have developed towards climate and environmental adaptation. IRPVS can be accessed at http://irpvs.clinbioinfosspa.es/

  Study EGAS00001006758

• GCparagon: Evaluation and correction of GC biases in cell-free DNA at the fragment level

  We present GCparagon, a two-stage algorithm for computing and correcting GC biases in cell-free DNA (cfDNA) samples. The length of the highly fragmented cfDNAs and the number of GC bases are essential parameters in the calculations. Regions of low mappability, known reference genome assembly errors and regions surrounding assembly gaps are excluded from the bias computation. GCparagon outputs a bias matrix and an optional tagged BAM file with GC bias balance weights as alignment tags. Parallelization allows calculation of a GC bias estimate in less than 2 minutes per sample with between 99.0% and 99.9% of fragments already corrected. We propose that GCparagon can help standardize cfDNA applications and evaluate the impact of GC bias on algorithms used in the analysis of liquid biopsy data.

  Study EGAS00001006963

• Transcriptome human nasal epithelium

  1. Odors are detected, firstly, by olfactory sensory neurons (OSNs) in the olfactory epithelium of the nose. This neurons then project directly to the olfactory bulb in the brain. Olfaction depends on cellular regeneration of the OE, olfactory bulb and hippocampus, and on their continual re-wiring. The olfactory neural pathway includes regions of the frontal, temporal and limbic brain, which in turn overlap with brain areas involved in brain disorders. OSNs are the only aspect of the human brain exposed to the external environment. This not only makes them vulnerable to environmental changes, but also accessible for biomedical studies. We have already sequenced and developed a protocol for analyzing the transcriptome of mouse main olfactory epithelium and single OSNs. We propose here to perform a similar study for samples from the human olfactory epithelium. We have developed a minimally invasive method for obtaining human OSNs, among other cells from the nasal epithelium. In this experiment, we have obtained cell samples from the olfactory epithelium, including OSN, from healthy volunteers. We would like to further characterize them by RNA sequencing. This will give us valuable insight into human olfaction. It will also provide a first step into a new avenue to study, and find biomarkers for, brain diseases though the analysis of these easily available neurons. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Dataset EGAD00001002226

• Direct Comparative Analysis of 10X Genomics Chromium and Smart-seq2

  Single cell RNA sequencing (scRNA-seq) is widely used for profiling transcriptomes of individual cells. The droplet-based 10X Genomics Chromium (10X) approach and the plate-based Smart-seq2 full-length method are two frequently-used scRNA-seq platforms, yet there are only a few thorough and systematic comparisons of their advantages and limitations. Here, by directly comparing the scRNA-seq data by the two platforms from the same samples of CD45- cells, we systematically evaluated their features using a wide spectrum of analysis. Smart-seq2 detected more genes in a cell, especially low abundance transcripts as well as alternatively spliced transcripts, but captured higher proportion of mitochondrial genes. The composite of Smart-seq2 data also resembled bulk RNA-seq data better. For 10X-based data, we observed higher noise for mRNA in the low expression level. Despite the poly(A) enrichment, approximately 10-30% of all detected transcripts by both platforms were from non-coding genes, with lncRNA accounting for a higher proportion in 10X. 10X-based data displayed more severe dropout problem, especially for genes with lower expression levels. However, 10X-data can better detect rare cell types given its ability to cover a large number of cells. In addition, each platform detected different sets of differentially expressed genes between cell clusters, indicating the complementary nature of these technologies. Our comprehensive benchmark analysis offers the basis for selecting the optimal scRNA-seq strategy based on the objectives of each study.

  Dataset EGAD00001005448

• Programmatic submission based on XML

  Programmatic submissions (XML based) For further information please check our Submission FAQs, submission quickguide as well as submission terms! Introduction Besides the Submitter Portal tool, EGA supports programmatic sequence and clinical data metadata submissions. If you are not sure what this means, you may want to explore our brief metadata introduction. Programmatic submissions are recommended for array-based submission. Moreove, it may be of help if your submission is recurrent or it is difficult to manage manually due to its sheer size. Otherwise, we highly recommend using the Submitter Portal to perform submissions. In this page we will guide you through the required steps to programmatically submit data to the EGA. Programmatic submissions require your metadata to be structured for an easy and straightforward validation and archival. It basically consists in formatting your metadata as Extensible markup language (XML) files and submitting them to the EGA using the WEBIN Before submitting metadata to the EGA, it is important to ensure that the information in your XML files is compliant with our standards. You can see further details on how these standards are maintained at EGA at our EGA Schemas documentation page. Using WEBIN, you can validate your XML files against EGA's schemas to ensure that your metadata is compliant before submission. WEBIN services WEBIN production service WEBIN test service We advise you to submit your metadata to the test service when submitting to the production service for the first time. The test service is identical to the production service except that all submissions will be discarded in the following 24 hours. This allows you to learn about the submission process without having to worry about data being submitted. Authentication Authentication is required each time a submission is made. The submission service uses HTTPS protocol for metadata encryption and identification to provide a secure submission environment. Data file upload Both Runs and Analyses reference files (e.g. FASTQ need to be uploaded to the EGA before these metadata objects are submitted. In other words, if you submit a Run that references a file that we cannot find associated with your account, the metadata submission will fail. See further details on how to upload your files in our File Upload documentation. Metadata model of the EGA Our metadata model is formed by multiple metadata objects. Check further details in our documentation at our EGA Schema documentation page. Working with EGA XMLs files Now that the basic concepts of the EGA metadata have been described, you can start preparing your programmatic submission through XML. Here you will find the guidance on how to prepare the XML files. Programmatic Submission Tutorial Video Take a look at the Programmatic Submission Tutorial Video, which explains the workflow of a programmatic submission and goes over an example metadata submission. Programmatic Submission Tutorial Video. When building your XML files, we recommend using text editors (e.g.Sublime Text or VisualStudio) that allow you to visualise the structure of the XML with ease. Furthermore, these editors constantly check the consistency of the XML structure. Alternatively, and if the submission consists of a big number of objects (specially analyses), you may find the tool star2xml handy. This tool allows for a direct conversion between metadata in a tabular format (e.g. a spreadsheet) into XMLs. Identifying objects: Aliases and center names Every EGA object must be uniquely identified within the submission account using their alias attribute. The aliases can be used in submissions to make references between EGA objects. Let us dig into EGA's use of aliases and center names: alias: every object should have a name that is unique within your submission account. Once submitted successfully, every alias will be assigned a unique and permanent accession (EGA ID). refname: when an object references another by its alias, the alias of the referenced object goes into the "refname" attribute of the referencing object. For example, if a sample has the alias "sample1", and an experiment uses this sample, then the experiment's "EXPERIMENT/SAMPLE/refname" attribute should be "sample1". center_name: The "center_name" attribute is required within the submission XML and, if not provided when the object is submitted, it will be automatically filled using your default EGA account center_name. This element is the "controlled vocabulary acronym or abbreviation that is provided to the account holder when the account is first generated". If the submitter is brokering a submission for another institute, the submitter should use their special broker account name in broker_name while the data centre acronym remains in center_name. Log-in details should have been provided when you requested a submission account. Please contact our Helpdesk team if you have any questions. run_center: Many submitting centers contract out the actual sample sequencing to another center. In these cases, the sequencing center should be acknowledged in the run_center attribute. Again, this is controlled vocabulary and the acronym should be sought from EGA helpdesk before submitting. Please contact our Helpdesk team if you have any questions. Prepare your XMLs The goal of this section is to provide sufficient information to be able to create the metadata XML documents required for programmatic submissions. Please note, the EGA utilises the XML schemas maintained at the European Nucleotide Archive (ENA). It is important due to the fact that by using a similar system, some pieces of documentation from the ENA's programmatic submission can also help you with your programmatic submission to the EGA. For example, you can submit programmatically without using a Submission XML by following the steps at Submission actions without submission XML. A submission does not have to contain all different types of XMLs. For example, it is possible to submit only a few samples; or a study that is later to be referenced. You can submit each object one by one, or submit all in a batch: you choose what method of submission works best for you. We do recommend, nevertheless, that you submit the objects to be referenced (e.g. samples or studies) first, and the objects that reference these (e.g. experiments or datasets) afterwards. You can see a graphical view of these objects and their relationships at our EGA Schemas page. Independently of the submission scenario, you will always require a Dataset XML. The entity of a dataset is what is used to control access to the given data, in the form of runs or analyses. In other words, when a requester is granted access, it is through the dataset and the objects (e.g. runs or analyses) that the dataset contains, granting access to them in one go. Given the nature of the EGA, a dataset XML will always be required for the data access. First, we will differentiate between submissions of "raw" and "processed" data: Runs and Analyses, respectively. Run data submissions Raw data derives from instruments "as is". For example, a plain sequence file (e.g. FASTQ or unaligned BAM files) would be considered raw data. A typical raw (unaligned) sequence read submission consists of 8 XMLs: Submission Study Sample Experiment Run DAC Policy Dataset When technical reads (e.g. barcodes, adaptors or linkers) are included in the submitted raw sequences, a spot descriptor must be submitted to describe the position of the technical reads so that they can be removed. The following data files can be submitted without providing spot descriptor information in the experiment/run XML: BAM files (single reads) SFF files (single reads without barcodes) FastQ files (single reads without any technical reads) Complete Genomics files Analysis data submissions Processed data is, in some way, refined raw data. This includes raw data that has been processed by some form of analysis method (e.g. alignment, noise reduction, etc.). For example, an aligned sequence (e.g. BAM file), that was created using raw FASTQ files, would be a processed file. This category includes most types of data: sequence alignment files (e.g. BAM or CRAM), clinical data (e.g. phenopackets), sequence variation files (e.g. VCF), sequence annotation, etc. A typical EGA analysis data submission consists of 7 EGA XML: Submission Study Sample Analysis DAC Policy Dataset We accept three different types of analysis data submissions: BAM files (for multiple read alignments) VCF files (for sequence variations) Phenotype files (in any format) In anycase, keep in mind that samples must be created in order to be referenced in the analyses. In other words, the provenance of the information within the BAM, VCF and phenotype files Example XMLs Below you can find a non-extensive list of example XMLs with descriptive fields (i.e. explaining what to provide in each field). Furthermore, you can also find real examples (i.e. the true value of the provided fields) in our GitHub repository. Submission XML The submission XML is used to validate, submit or update any number of other objects. The submission XML refers to other XMLs. New submissions use the ADD action to submit new objects. Object updates are done using the MODIFY action and objects can be validated using the VERIFY action. Descriptive submission XML example True values submission XML example Study XML The study XML is used to describe the study containing a title, a study type and abstract as it would appear in a publication. Descriptive study XML example True values study XML example Please use the following notation within the property "STUDY_LINKS" when including PubMed citations in the Study XML: <STUDY_LINKS> <STUDY_LINK> <XREF_LINK> <DB>PUBMED</DB> <ID>18987735</ID> </XREF_LINK> </STUDY_LINK> </STUDY_LINKS> Sample XML The sample XML is used to describe the samples used to obtain the data, whether they were sequenced, measured in any other way, or have an associated phenotype. The mandatory fields include information about the taxonomy of the sample, sex, subject ID and phenotype. For example, the mandatory attribute fields for each sample would look like these, within the array of "SAMPLE_ATTRIBUTES": <SAMPLE_ATTRIBUTES> <SAMPLE_ATTRIBUTE> <TAG>subject_id</TAG> <VALUE>free text!</VALUE> </SAMPLE_ATTRIBUTE> <SAMPLE_ATTRIBUTE> <TAG>sex</TAG> <VALUE>female/male/unknown</VALUE> </SAMPLE_ATTRIBUTE> <SAMPLE_ATTRIBUTE> <TAG>phenotype</TAG> <VALUE>Free text, EFO terms (e.g. EFO:0000574) are recommended</VALUE> </SAMPLE_ATTRIBUTE> </SAMPLE_ATTRIBUTES> Sample is one of the most important objects to be described biologically, it is highly recommended that “TAG-VALUE” pairs are generated as SAMPLE_ATTRIBUTES to describe the sample in as much detail as possible. For example, were we to give the population ancestry of the sample, we could add a new attribute to the array, in which, for example, we would indicate that the sample derives from an individual of "Mende in Sierra Leone" (MSL), with an african ancestry: <SAMPLE_ATTRIBUTE> <TAG>Population</TAG> <VALUE>MSL</VALUE> </SAMPLE_ATTRIBUTE> Given that VALUE and TAG are free text, the combinations are limitless in order to give you full flexibility on the information you want to provide. We recommend you use the Experimental Factor Ontology (EFO) to describe the phenotypes of your samples. You can provide more than one phenotype by adding more items to the array of SAMPLE_ATTRIBUTES. Phenotypes considered essential for understanding the data submission should be provided. Each phenotype described should be listed as a separate sample attribute <SAMPLE_ATTRIBUTE> </SAMPLE_ATTRIBUTE>. There is no limit to the number of phenotypes that can be submitted. If a suitable EFO accession cannot be found for your phenotype attribute, please consider using another controlled ontology database (e.g. HPO, MONDO, etc.) before using free text. Descriptive sample XML example True values sample XML example Experiment XML The experiment XML is used to describe the experimental setup, including instrument platform and model details, library preparation details, and any additional information required to correctly interpret the submitted data. Where any of these values differ between runs, a new experiment object must exist, since runs are grouped by experiments. Each experiment references a study and a sample by alias, or if previously-submitted, by accession. Pooled data must be demultiplexed by barcode for submission. Descriptive experiment ( Illumina paired read ) XML example True values experiment ( Illumina paired read ) XML example Run XML The run XML is used to associate data files with experiments and typically comprises a single data file (e.g. a FASTQ file). Please note that pooled samples should be de-multiplexed prior submission and submitted as different runs. Descriptive run XML example True values run XML example Analysis XML Given that an analysis can be used to submit any type of processed data to the EGA, we will list below an example of each of the three most common types of analysis XMLs submitted to the EGA: sequence alignments (e.g. BAM files); sequence variation (e.g. VCF files); and clinical metadata or phenotypes (e.g. phenopackets). Regardless of the type of processed data submitted in the analysis, the analysis must be associated with a Study and can reference multiple types of other objects, from samples to experiments, if they are available at the EGA. Just like with Runs, whenever a file is submitted to the EGA through an analysis object, the file MD5 checksums must be present, in order for the EGA to validate file integrity upon transfer. This also includes index files when applicable (e.g. .bai.md5 files). Ideally, any analysis that uses a reference sequence for some kind of alignment (e.g. BAM, CRAM or VCF files), would contain metadata about the alignment, such as INSDC reference assemblies and sequences, by either using accessions (e.g. CM000663.1) or common labels (e.g. GRCh37). Read alignment (BAM) Analysis XML The Analysis can be used to submit BAM alignments to EGA. Only one BAM file can be submitted in each analysis and the samples used within the BAM read groups must be associated with Samples. Descriptive bam alignments XML example True values bam alignments XML example Sequence variation (VCF) Analysis XML The Analysis can be used to submit VCF files to EGA. Only one VCF file can be submitted in each analysis and the samples used within the VCF files must be associated with Samples. Download analysis XML (VCF) Phenotype files The Analysis XML can be used to submit phenotype files to the EGA. Only one phenotype file can be submitted in each analysis and the samples used within the phenotype files must be associated with EGA Samples. Download analysis XML (Phenotype) DAC XML The DAC XML describes the Data Access Committee (DAC) affiliated to the data submission. The DAC may consist of a group or a single individual and is responsible for the data access decisions based on the application procedure described in the POLICY.XML. As with any other object, if it was already submitted to the EGA, there is no need to submit it again: you can reference an existing object within the EGA. Hence, A DAC XML does not need to be provided if your submission is affiliated to an existing EGA DAC.. Further information on DACs can be found here, and you can always contact our Helpdesk team if you have further inquiries. Descriptive dac XML example True values dac XML example Policy XML The Policy XML describes the Data Access Agreement (DAA) to be affiliated to the named Data Access Committee. Descriptive policy XML example True values study XML example Dataset XML The dataset XML describes the data files, defined by the Run.XML and Analysis.XML, that make up the dataset and links the collection of data files to a specified Policy. The dataset xml is commonly the last metadata object to be submitted, since it references multiple other entities. Please consider the number of datasets that your submission consists of. For example, a case-control study is likely to consist of at least two datasets. In addition, we suggest that multiple datasets should be described for studies using the same samples but different sequence technologies. Descriptive dataset XML example True values dataset XML example Validating and submitting your EGA Validating EGA's XMLs through Webin After you have ensured that the XMLs are properly formatted and contain all the required information. You can proceed to validate and submit your data. Use the curl command to validate your XML file: Once you have prepared your XML file and asserted you have access to Webin, you can validate your XML file programmatically against EGA's schemas using the curl command. There are multiple ways in which you can validate your XMLs. This variety has to do with the fact that: (1) there are 2 instances of Webin (test and production); and (2) that validation is a default step during submission. In other words, any time that you submit your data through Webin, it will be validated automatically before being accepted. This allows for 4 possible routes of validation, all having the same validation result: validating or submitting to either the production service or the test service of Webin. For example, directly validating a "study" object XML in the testing service (wwwdev…) would look like the following: curl -u <USERNAME>:<PASSWORD> -F "ACTION=VALIDATE" "https://wwwdev.ebi.ac.uk/ena/submit/drop-box/submit/" -F "STUDY=@study.xml" In this command, you would need to replace <USERNAME> and <PASSWORD> with your EGA account username and password, respectively. You would also replace <INPUT_FILE> with the path to your XML file. A mock example would look like the following: curl -u ega-test-data@ebi.ac.uk:egarocks -F "ACTION=VALIDATE" "https://wwwdev.ebi.ac.uk/ena/submit/drop-box/submit/" -F "STUDY=@study.xml" The validation attempt can have different results depending on the given arguments: If your XML file is valid according to EGA's schemas, you will see a message indicating that your XML file is compliant. For example, see below for our mock example, where the "success" was "true" (i.e. no validation errors found). Nevertheless, notice how the "<STUDY accession=" is empty: it is because we were simply validating, so the study did not get an accession or ID. <?xml version="1.0" encoding="UTF-8"?> <?xml-stylesheet type="text/xsl" href="receipt.xsl"?> <RECEIPT receiptDate="2023-04-11T15:19:28.850+01:00" submissionFile="submission-EBI-TEST_1681222768850.xml" success="true"> <STUDY accession="" alias="Mock example" status="PRIVATE"/> <SUBMISSION accession="" alias="SUBMISSION-11-04-2023-15:19:28:840"/> <MESSAGES> <INFO>VALIDATE action has been specified.</INFO> <INFO>Submission has been rolled back.</INFO> <INFO>This submission is a TEST submission and will be discarded within 24 hours</INFO> </MESSAGES> <ACTIONS>VALIDATE</ACTIONS> <ACTIONS>PROTECT</ACTIONS> If there are any errors or warnings, the tool will display them, allowing you to correct them before submitting your data to EGA. For example, in the following response, it is said that the object we were trying to submit was already existing, and therefore the "success" was "false". <?xml version="1.0" encoding="UTF-8"?> <?xml-stylesheet type="text/xsl" href="receipt.xsl"?> <RECEIPT receiptDate="2023-04-11T15:12:35.609+01:00" submissionFile="submission-EBI-TEST_1681222355609.xml" success="false"> <STUDY alias="Example!_Human Microbiome Project SP56J" status="PRIVATE" holdUntilDate="2023-03-11Z"/> <SUBMISSION alias="SUBMISSION-11-04-2023-15:12:35:576"/> <MESSAGES> <ERROR>In study, alias: "Example!_Human Microbiome Project SP56J". The object being added already exists in the submission account with accession: "ERP127584".</ERROR> <INFO>VALIDATE action has been specified.</INFO> <INFO>Submission has been rolled back.</INFO> <INFO>This submission is a TEST submission and will be discarded within 24 hours</INFO> </MESSAGES> <ACTIONS>VALIDATE</ACTIONS> <ACTIONS>PROTECT</ACTIONS> If the curl command retrieves no response at all, please double check if your username and password are correctly provided. Also notice the "ACTION=..." argument passed to the Curl command. This specifies the action to take during the call to Webin, so we do not need a "Submission" XML just for a validation attempt. See more at submission actions without submission XML. Furthermore, validation of multiple files or objects (e.g. sample, experiment, study…) can be done in a single command by adding more arguments (i.e. '-F'). For example: curl -u <USERNAME>:<PASSWORD> -F "ACTION=VALIDATE" "https://wwwdev.ebi.ac.uk/ena/submit/drop-box/submit/" -F "STUDY=@study.xml" -F "SAMPLE=@sample.xml" -F "DATASET=@dataset.xml" As mentioned above, beside "validate" action in the test environment, you can also validate your metadata by three other methods: "Validate" in the production server. From our example above, you simply need to take the "dev" away from the URL. curl -u <USERNAME>:<PASSWORD> -F "ACTION=VALIDATE" "https://www.ebi.ac.uk/ena/submit/drop-box/submit/" -F "STUDY=@study.xml" "Add" in the development server. From our example above, you would simply need to replace the action: from "validate" to "add". Whatever is submitted to this service will be discarded in 24h, so whether something gets submitted or not would not matter in the long run. curl -u <USERNAME>:<PASSWORD> -F "ACTION=ADD" "https://wwwdev.ebi.ac.uk/ena/submit/drop-box/submit/" -F "STUDY=@study.xml" "Add" in the productionserver. A combination of the previous two methods, which would render this attempt into a submission. This path is just to be taken when you are sure your metadata is compliant and what you want to submit. curl -u <USERNAME>:<PASSWORD> -F "ACTION=ADD" "https://www.ebi.ac.uk/ena/submit/drop-box/submit/" -F "STUDY=@study.xml" What happens after the submission of a dataset XML? Once you have completed the registration of your dataset/s please contact our Helpdesk Team to provide a release date for your study. Please note that all datasets affiliated to unreleased studies are automatically placed on hold until the authorised submitter or DAC contact contact the EGA Helpdesk for the study to be released. We strongly advise you not to delete your data until EGA Helpdesk confirms that your data has been successfully archived.

  Documentation submission/metadata/submission/programmatic-submission-xml

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• WTCCC2 Pre-eclampsia Study

  A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.

  Study EGAS00001003349

• Discordant_Monozygotic_Twins_ALS (Epigenetics)

  We conducted a multi-omics study on a monozygotic twin pair discordant for amyotrophic lateral sclerosis. Data refers to 7 samples that are technical replicates from biological samples collected from the twins at two different time points (T1 and T2).

  Dataset EGAD00010002716

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  Dataset EGAD00001006877

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• Bladder Cancer Organoids as a Functional System to Model Different Disease Stages and Therapy Response

  The study 'Bladder Cancer Organoids as a Functional System to Model Different Disease Stages and Therapy Response' reports the genomic characterization at the single allele level upon Whole Exome Sequencing of Bladder Cancer (BLCa) Patient Tumor (PT) samples obtained from 18 patients and corresponding Patient Derived Organoids (PDOs), implementing the SPICE pipeline (Ciani Y et al). Our cohort included 21 PTs and 22 PDOs. In this study, we generated a unique biobank resource of BLCa organoids that encompasses a broad spectrum of disease stages. We demonstrated that PDOs retain cancer heterogeneity and mutational burden. Furthermore, we observed that BLCa PDO can have different morphologies which may reflect tumor-specific features. Indeed, a solid morphology may be associated with more advanced tumors, as supported by the high PDO genomic burden and high primary tumor stage. Moreover, with our drug screening pipeline, we demonstrated the clinical relevance and feasibility of using a BLCa PDO-based drug assay for comparing the standard of care (SOC) drugs with compounds not currently in use for BLCa. Response to SOC was highly heterogeneous with approximately 50% of non-muscle invasive bladder cancer and 33% of muscle invasive bladder cancer PDOs showing no or minimal response. The most effective targeted therapy was lapatinib. We used an integrative analysis of drug response profiles with matched PDO genomic analysis to determine enrichment thresholds for candidate markers of therapy resistance and sensitivity. Importantly, by assessing the clinical history of longitudinally sampled cases, the clonal evolution of the disease could be determined and matched with PDO drug response profiles.

  Study phs003149