11096 results for "monedas ultimate team FC 26 Visité Buyfc26coins.com. Servicio premium a un precio estándar. Increíble..XLis"

in 16.84 milliseconds.

• The Iberian Roma genetic variant server

  The Roma are the most numerous ethnic minority in Europe. The Iberian Roma arrived in the Iberian Peninsula five centuries ago and still today, they keep a strong group identity. Demographic and cultural reasons lie behind a high rate of Mendelian disease often related to founder variants. We have analysed exome data from 119 Iberian Roma individuals collected from 2018 to 2020. A database of variant frequency has been implemented (IRPVS) and made available online. We have analysed the carrier rate of founder private alleles as well as pathogenic variants present in the general population. Significant enrichment in structural variants involving gene clusters related to keratinization and epidermal growth suggest that evolutive mechanisms have developed towards climate and environmental adaptation. IRPVS can be accessed at http://irpvs.clinbioinfosspa.es/

  Study EGAS00001006758

• GCparagon: Evaluation and correction of GC biases in cell-free DNA at the fragment level

  We present GCparagon, a two-stage algorithm for computing and correcting GC biases in cell-free DNA (cfDNA) samples. The length of the highly fragmented cfDNAs and the number of GC bases are essential parameters in the calculations. Regions of low mappability, known reference genome assembly errors and regions surrounding assembly gaps are excluded from the bias computation. GCparagon outputs a bias matrix and an optional tagged BAM file with GC bias balance weights as alignment tags. Parallelization allows calculation of a GC bias estimate in less than 2 minutes per sample with between 99.0% and 99.9% of fragments already corrected. We propose that GCparagon can help standardize cfDNA applications and evaluate the impact of GC bias on algorithms used in the analysis of liquid biopsy data.

  Study EGAS00001006963

• Evolutionary landscape of clonal hematopoiesis in 3359 individuals from the general population

  This project contains longitudinal data for processed somatic variant calls and data on core phenotypic variables for 3359 community-based individuals ≥60 years, a sub-cohort of the population-based Lifelines cohort (167,729 participants). Cases with peripheral blood count abnormalities and population-based controls were included. Next-generation sequencing data were generated with a median time period of 43 months between baseline and follow-up visit. For 327 individuals a third visit sample was included. Error-corrected sequencing was performed using single-molecule tagged molecular inversion probes targeting 27 myeloid and lymphoid driver genes. The threshold for variant calling was set at ≥1% VAF and ≥10 consensus variant reads. Details on sample selection, sequencing technique, variant calling procedures and data curation are described (van Zeventer et al. 2023).

  Study EGAS00001007087

• Transcriptome human nasal epithelium

  1. Odors are detected, firstly, by olfactory sensory neurons (OSNs) in the olfactory epithelium of the nose. This neurons then project directly to the olfactory bulb in the brain. Olfaction depends on cellular regeneration of the OE, olfactory bulb and hippocampus, and on their continual re-wiring. The olfactory neural pathway includes regions of the frontal, temporal and limbic brain, which in turn overlap with brain areas involved in brain disorders. OSNs are the only aspect of the human brain exposed to the external environment. This not only makes them vulnerable to environmental changes, but also accessible for biomedical studies. We have already sequenced and developed a protocol for analyzing the transcriptome of mouse main olfactory epithelium and single OSNs. We propose here to perform a similar study for samples from the human olfactory epithelium. We have developed a minimally invasive method for obtaining human OSNs, among other cells from the nasal epithelium. In this experiment, we have obtained cell samples from the olfactory epithelium, including OSN, from healthy volunteers. We would like to further characterize them by RNA sequencing. This will give us valuable insight into human olfaction. It will also provide a first step into a new avenue to study, and find biomarkers for, brain diseases though the analysis of these easily available neurons. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Dataset EGAD00001002226

• Direct Comparative Analysis of 10X Genomics Chromium and Smart-seq2

  Single cell RNA sequencing (scRNA-seq) is widely used for profiling transcriptomes of individual cells. The droplet-based 10X Genomics Chromium (10X) approach and the plate-based Smart-seq2 full-length method are two frequently-used scRNA-seq platforms, yet there are only a few thorough and systematic comparisons of their advantages and limitations. Here, by directly comparing the scRNA-seq data by the two platforms from the same samples of CD45- cells, we systematically evaluated their features using a wide spectrum of analysis. Smart-seq2 detected more genes in a cell, especially low abundance transcripts as well as alternatively spliced transcripts, but captured higher proportion of mitochondrial genes. The composite of Smart-seq2 data also resembled bulk RNA-seq data better. For 10X-based data, we observed higher noise for mRNA in the low expression level. Despite the poly(A) enrichment, approximately 10-30% of all detected transcripts by both platforms were from non-coding genes, with lncRNA accounting for a higher proportion in 10X. 10X-based data displayed more severe dropout problem, especially for genes with lower expression levels. However, 10X-data can better detect rare cell types given its ability to cover a large number of cells. In addition, each platform detected different sets of differentially expressed genes between cell clusters, indicating the complementary nature of these technologies. Our comprehensive benchmark analysis offers the basis for selecting the optimal scRNA-seq strategy based on the objectives of each study.

  Dataset EGAD00001005448

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506