17511 results for "the best way to get coins in fc 26 Navštivte Buyfc26coins.com Společnost známá transparentními transakcemi..CQ2q"

in 39.60 milliseconds.

• BLUEPRINT ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  Study EGAS00001000326

• FASTQ Data from In Situ Hi-C on Medulloblastoma Tissue Samples

  29 Hi-C datasets [8 G3 (MB3667, MB3687, MB3690, MB3692, MB3693, MB4010, MB4037, MB4141), 13 G4 (MB0558, MB3510, MB3670, MB3689, MB3716, MB3760, MB3761, MB3807, MB4079, MB4132, MB4174, MBSF7, SNC_2_5), 7 SHH (MB3612, MB3661, MB3662, MB3695, MB3697, MB3724, MB4143), and 1 WNT (MB4036)]. Fresh tissue samples were obtained from The Hospital for Sick Children (Toronto, ON). In situ Hi-C libraries were generated using approximately 2.5 million dissociated cells as input. All Hi-C libraries were sequenced at 150 bp PE with a Hi-Seq X instrument (Illumina) at McGill Genome Centre (Montreal, QC).

  Dataset EGAD50000000771

• 252 human breast cancer samples in WGS and WES

  We analyzed chromothripsis in 252 human breast cancers from two patient cohorts (149 metastatic breast cancers, 63 untreated primary tumors, 29 local relapses, 11 longitudinal pairs) using whole-genome and whole-exome (paired) sequencing. A lot of the WGS samples were sequenced on Illumina HiSeq X-Ten using Illumina TruSeq Nano DNA. For exome sequencing Agilent_SureSelect_V5+UTRs has been used (sequencing on Hiseq2000, Hiseq2500 and Hiseq4000). For exome sequencing Agilent_SureSelect_V5+UTRs has been used (sequencing on Hiseq2000, Hiseq2500 and Hiseq4000).

  Dataset EGAD00001007563

• DDD_1 hypermutated individual

  CRAM files and VCF for DDD_1 and their parents. Also de novo mutations file for hypermutated DDD_1 child as described in the manuscript ‘Genetic and chemotherapeutic influences of germline hypermutation’ by Kaplanis et al. which will be published in Nature shortly.

  Dataset EGAD00001008497

• TIGER samples

  The TIGER samples dataset contains PISA cohort samples which consist of paired RNA-seq and genotyping array data. It contains 127 RNA-seq pair-end samples in fastq format and 127 individuals genotypes in PLINK format.

  Dataset EGAD00001007990

• EGAD00010000702

  SNP-chip genotyping data for one proband in the DDD study (Ref : Carvalho AJHG 2015)

  Dataset EGAD00010000702

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Small RNA sequencing of human oocytes and early embryos

  This dataset contains single-end fastq files for human oocytes (n=12), zygotes (n=5), and early embryos (n=10) sequenced with Illumina NextSeq500. The sequencing libraries were prepared from single oocytes, zygotes, and embryos in two batches.

  Dataset EGAD50000000227