7199 results for "({!join from=dataset_studies to=id v=$q1}) OR ("transcriptome" OR "RNA-seq" OR "rna sequencing" OR "rna-sequencing")"

in 12.43 milliseconds.

• Phenotype, genotype, and transcriptome data from three South Eastern Bantu groups in the SABR study

  Phenotypic data, whole genome sequencing, blood RNA-seq, imputed variant calls, cell type estimates, gene expression levels, splicing measurements, and analysis covariates from South African Blood Regulatory (SABR) resource participants, which includes South Eastern Bantu-speaking groups.

  Dataset EGAD50000001477

• RNA-seq transcriptome of bronchial brush samples from COPD and control

  Human subjects (COPD patients or apparently healthy controls) where investigated by bronchoscopy and a 5 mm brush was used to sample the subsegment airways of the right lung. The material obtained mainly consist of bronchial epithelial cells plus some contamination with leukocytes. For further details see Ziegler-Heitbrock et al, European Respiratory Journal, 40:823-829, 2012.

  Dataset EGAD00001002003

• RNA-seq analysis of TGF-β-induced transcriptional changes in 19TT cancer-associated fibroblasts

  The dataset contains 6 samples, three biological replicates for vehicle-treated 19TT cells, and three biological replicates for TGF-β-treated 19TT cells. The dataset was generated by the next generation high throughput sequencing. Strand specific transcriptome library construction is completed by enriching mRNA from total RNA, sequenced by DNBSEQ high throughput platform.

  Dataset EGAD50000001350

• ImmuNEO CD8 cell lines

  Paired RNA-Seq data from 16 samples of different tumors CD8+ T cells added to the study "Proteogenomic analysis reveals RNA as a source for tumor-agnostic neoantigen identification (H021)". Sequencing was performed on Illumina NextSeq 500. The sequencing was always paired

  Dataset EGAD50000000193

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• High-throughput sequencing data for study of molecular drivers of resistance to castration in localised prostate cancer

  Aligned whole-genome sequencing and RNA-seq of localised prostate cancer for study 'Loss of SNAI2 in prostate cancer correlates with clinical response to androgen deprivation therapy'.

  Dataset EGAD00001006640

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604