4955 results for "*oma"

in 36.75 milliseconds.

• Yale SPORE in Skin Cancer Project 2

  Understanding the relationship between tumor and peripheral immune environments could allow longitudinal immune monitoring in cancer. Here, we examined whether T cells that share the same TCRab and are found in both tumor and blood can be interrogated to gain insight into the ongoing tumor T cell response. Paired transcriptome and TCRab repertoire of circulating and tumor-infiltrating T cells were analyzed at the single cell level from matched tumor and blood from patients with metastatic melanoma. The data shared here consist of gene expression matrix and fastq files obtained from sequencing single-cell libraries generated with the Chromium (TM) 5' technique. For each of 18 immunotherapy naive and 11 previously treated melanoma patients, T cells (Live/CD45+/TcRab+) were FACS-sorted from PBMCs and freshly resected tumors. Metadata associated with each individual cell consist of Patient I.D., biological sex, immunotherapy status, amino acid and nucleotide CDR3 sequence of the TCR alpha and beta chain (obtained from matched VDJ region enriched libraries), and sequencing batch. Further details about previous treatment history and other clinical parameters can be found in the associated manuscripts (Lucca et al., 2021: PMID: 33651881; Lu et al., PMID: 39609626).

  Study phs002289

• MDACC GBM Data Access Committee

  Retrospective global-omics analyses of an anti-PD-L1 treated cohort of newly diagnosed glioblastoma.

  Dac EGAC50000000477

• Melanoma Genome Sequencing Project

  Melanoma is the most prevalent cause of skin cancer morbidity and mortality. In order to characterize the full range of somatic mutations that may drive the growth of melanoma, we are sequencing tumor and normal DNA from a set of roughly 150 melanomas. For the majority of samples (approximately 90% of the cases), mutations in protein coding genes will be assessed in the exonic DNA of tumor-normal pairs using hybrid capture and paired-end DNA sequencing. For a few of DNA samples (approximately 10% of the cases), the entire genomes will be analyzed to assess the possible contribution of complex structural rearrangements contributing to oncogenesis. The sequencing data are supplemented by copy number profiling on the same tumors using high-density SNP arrays. Integration of these approaches will enable the unbiased and comprehensive characterization of both known and novel recurrent DNA alterations that arise in melanoma.Versions 1-4 contain whole exome and bulk RNA sequencing data for patients with melanoma.Version 5 - We compared somatic genomic profiles from matched pre-treatment and post-resistance tumor biopsies in patients with metastatic melanoma who exhibited heterogeneous responses to immune checkpoint inhibitors (ICIs). This version includes whole exome sequencing (WES) data from 14 patients.

  Study phs000452

• Identification of Novel Immunotherapy Targets in Myeloma

  RNA sequencing (RNA-Seq) was performed on 94 multiple myeloma (MM) patient samples. We used genomic subgroup and high-risk markers to identify therapeutic targets, including TNFRSF17, GPRC5D, ITGA4, and LAX1, with low predicted toxicity and high specificity to MM and genomic subgroups such as those with TP53 alterations.

  Study phs003772

• MDACC Lymphoma & Myeloma WGS of Tumor and Non-tumor Cells in Multiple Myeloma

  FastQ files from paired tumor and non-tumor WGS data from patients diagnosed with newly diagnosed (n = 6), refractory/relapsed multiple myeloma (n = 3) or plasma cell leukemia (n = 1). These samples presented >95% tumor PCs in bone marrow aspirates. Plasma cells and T cells (non-tumor cells) were isolated from bone marrow aspirates using a magnetic approach.

  Dac EGAC50000000282

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• MDACC Lymphoma & Myeloma scRNAseq of Plasma Cells in Multiple Myeloma

  FastQ files from Chromium single cell 5' gene expression and B-cell receptor sequencing of plasma cells from patients diagnosed with a monoclonal gammopathy of the multiple myeloma spectrum, including the precursor stages MGUS (n =13) and SMM (n = 22); newly diagnosed (n = 17); relapsed (n = 15); and plasma cell leukemia (n = 2); and 3 controls.

  Dac EGAC50000000271

• International Cancer Proteogenome Consortium (ICPC): Proteogenomics of Oral Squamous Cell Carcinoma in Taiwan

  Oral cavity squamous cell carcinoma (OSCC) is the major subtype (~90%) of oral cancer, which is leading cancer with high mortality worldwide. The environmental risk factors associated with OSCC are quite different in Taiwan as compared to other populations. In most non-Taiwanese populations, OSCC is often associated with tobacco chewing, cigarette smoking, alcohol drinking, or human papillomavirus (HPV) infection. In Taiwan, in contrast, the OSCC occurs mainly in males aged 30 years or older who have habitual betel nut chewing, cigarette smoking, and alcohol drinking. To uncover molecular mechanisms and identify new therapeutic strategies of oral squamous cell carcinoma, this study recruited 112 treatment-naïve OSCC patients and generated multi-omics data, including WES, RNA-Seq, TMT-labeled proteomes, and phosphoproteomes from paired normal/tumor tissues. We have investigated our multi-omics data, covering molecular characterizations such as mutation signatures, impacts of mutations on RNA/protein/phosphoprotein, RNA-protein correlation, somatic copy number alteration, and the relationship with RNA & protein, proteome, and phosphoproteome analysis (T vs NAT), novel peptides (somatic variants, neoantigens, CT antigens, T cell receptors, etc.), as well as molecular subtyping (& pathway analysis). Notably, we have discovered a higher frequency of APOBEC3B deletion polymorphism in the Taiwanese population, and APOBEC3A is a potential prognostic biomarker. Our proteogenomic data enable us to further stratify patients into four groups based on APOBE3A expression level, which is found inversely correlated with EGFR expression. Therefore, the patients with high EGFR and low APOBEC3A expression may benefit from anti-EGFR therapy, while those with low EGFR and high APOBEC3A expression may benefit from immunotherapy. To clarify if there is an interaction between genetic polymorphisms and betel nut chewing habit in Taiwanese OSCC, we plan to concurrently evaluate the effect of habitual betel nut chewing on the gene mutation pattern, the dysregulated protein/phosphoproteins as novel biomarkers and/or therapeutic targets, and the molecular subtyping of patients for effective treatments. 

  Study phs002580

• Childhood Cancer Data Initiative (CCDI): Pediatric In Vivo Testing Program - Neuroblastoma

  The goal of NCI's Pediatric In Vivo Testing Consortium (PIVOT) is to advance the development of effective treatments for pediatric cancers through preclinical in vivo testing of novel therapeutic agents. To design impactful experiments that can be rapidly translated to the clinic, PIVOT investigators require comprehensive genomic characterization of the patient-derived xenograft (PDX) models used across the consortium. This robust experimental design enhances collaboration with industry partners by providing proof-of-concept data for drugs in development. As part of this effort, neuroblastoma PDX models are being molecularly characterized to identify promising therapeutic candidates. The molecular profiling includes whole exome sequencing (WES), RNA-seq, MethylEPIC array, CytoSNP array, and DNA fingerprinting for quality control. Additionally, demographic and clinical data (e.g., diagnosis, disease site, disease status) are shared. These characterized PDX models, matched with patient tumors, guide model selection for preclinical drug testing.

  Study phs003163

• TIGER-LC High-Throughput Sequencing

  Intrahepatic cholangiocarcinoma (CCA) and hepatocellular carcinoma (HCC) are clinically disparate primary liver cancers with etiological and biological heterogeneity. We performed sequencing on multiple data levels of Thai CCA and HCC among the Thailand Initiative in Genomics and Expression Research for Liver Cancer (TIGER-LC) cohort using targeted OncoVar platform, whole exome, whole transcriptome, and whole genome metagenomic sequencing.

  Study phs001199

• A Clone's Genomic Stability as a Biomarker of Its DNA-Damage Resilience

  A main problem in the treatment of advanced cancers, including gastric cancers and glioblastoma, is the incertitude at which we predict how individual patients will respond to DNA-damaging agents, especially on the long run. Knowing the mechanism behind a patient's response, or the lack thereof, will help us depart from the oversimplified “more-is-better” and “one-size-fits-all” principles according to which DNA-damaging agents are administered. This will improve clinical outcome by allowing us to pinpoint those who would respond better and longer to lower doses than to higher doses of DNA-damaging agents. Under the assumption that the success of DNA-damaging therapy increases with the proliferation rate of a relatively homogeneous tumor population, there was little reason to assume anything other than monotonic dose-response relations. With the recent paradigm shift that most cancers are in fact DNA mosaic products of ongoing evolution, comes the urgency to reconsider these fundamental principles behind DNA-damaging therapy administration. As the developers of one of the first DNA deconvolution methods and with access to technologies to profile the transcriptomes of up to 10,000 cells simultaneously, we are equipped to embark on first personalized dose-finding strategies for DNA-damaging therapies. We will test the potential of the very long-term legacy that DNA-damage entails on a cell “genomic instability” as new biomarker of DNA-damage response. Our preliminary studies showed that, for most cancer types, DNA-damaging agents change a clone's genomic instability and that clones succumb to a limit in the amount of genomic instability they can tolerate. In particular, our results showed that patients with intermediate genomic instability have a very poor outcome and that this relation is only evident among treatment-naive patients, but not among patients treated with DNA-damaging agents. Further they show that we can measure genomic instability per clone and that clones with extreme genomic instability typically don't grow large. Our hypothesis that genomic instability, rather than proliferation rate, determines how sensitive a tumor is to DNA-damaging agents on the long-term, is founded on two unexpected findings. Patients with extremely high genomic instability per tumor clone have an exceptionally good outcome. Aim 1 will integrate exome- and single cell RNA-Seq (scRNA-Seq) data to characterize clones and to measure how much genomic instability they can tolerate. Low genomic instability is associated with reduced benefit from DNA-damaging agents. Aim 2 will use comet assays and treatment history to quantify DNA damage per clone, relating it to the clones' ability to tolerate DNA damage and to changes in the genomic instability of therapy-surviving clones.

  Study phs003762

• Assessing Individual Head and Neck Squamous Cell Carcinoma Patient Response to Therapy Through Integration of Functional and Genomic Data

  This study combines RNA sequencing (RNASeq), whole exome sequencing (WES), reverse phase protein array (RPPA) and copy number variation (CNV) data, along with a custom high throughput inhibitor assay to characterize tumor cells from patients with head and neck squamous cell carcinoma (HNSCC), in order to identify potential therapy targets on an individual patient basis. The data that will be available through dbGaP include the RNASeq, WES, RPPA and array CNV data for the tumor and matched normal samples. This study represents a proof-of-concept. No treatments were administered to patients as part of this study.

  Study phs003456

• Metabolic Biomarkers in Thoracic Cancers

  Here we present RNA sequencing (RNA-Seq) of non-small cell lung cancer (NSCLC) and adjacent lung tissue. These samples were acquired from primarily untreated, surgically resected primary tumors. The first analysis published with this data was to determine the metabolic signatures between primary tumors and adjacent lung tissue.The associated clinical trial (NCT02095808) includes patients with many kinds of thoracic cancers, including NSCLC and other diseases, such as thymoma and esophageal adenocarcinoma. However, the current dbGaP data is focused on the NSCLCs described in the associated paper.

  Study phs003880

• A Personalized Neoantigen Vaccine Generates Anti-Tumor Immunity in High-Risk Renal Cell Carcinoma

  Personalized cancer vaccines (PCVs) can generate circulating immune responses against predicted neoantigens. However, whether such responses can target cancer driver mutations, lead to immune recognition of a patient's tumor, and result in clinical activity are largely unknown, particularly in patients with lower mutation burden tumors. We conducted a phase I trial testing a neoantigen-targeting PCV in patients with high-risk, fully resected clear cell renal cell carcinoma (RCC; stage III or IV), with or without ipilimumab administered adjacent to the vaccine. At a median follow-up of 40.2 months from surgery, none of the 9 initial participants experienced a recurrence of RCC. No dose-limiting toxicities were observed. All patients generated T cell immune responses against PCV antigens, including RCC driver mutations in VHL, PBRM1, BAP1, KDM5C, and PIK3CA. Following vaccination, there was a durable expansion of peripheral T cell clones, and T cell reactivity against autologous tumor was detected in 7 of the 9 patients. Our results demonstrate that neoantigen-targeting PCVs in high-risk RCC are highly immunogenic, capable of targeting key driver mutations, and induce anti-tumor immunity. These observations, in conjunction with the absence of recurrence in all 9 vaccinated patients, highlights the promise of PCV as effective adjuvant therapy in RCC. We are submitting WES data from whole blood samples and tumor FFPE samples, and RNA-Seq data from tumor FFPE samples. We are also submitting RNA-Seq data from purified tumor samples. scRNA-seq data will be submitted for skin samples (vaccine site biopsies at Weeks 0, 4, and 13), tumor samples (including resected metastatic tumor samples for two patients), and normal kidney samples. Bulk TCR-seq data will be submitted for blood samples.

  Study phs003710

• CD4 T Cell Subsets in Human Metastatic Melanoma

  We used single-cell RNA-sequencing (scRNA-seq) to define CD4+ T-cell subsets in melanoma tumors from patients undergoing tumor resection. All patients received immune checkpoint blockade prior to surgery. We identified multiple subsets in the tumor with transcriptional features of suppressive function, including TR1 cells and FOXP3+ Treg cells. Based on transcriptional profiles, classical helper T cell subsets were not prevalent.

  Study phs003816

• Spatial Transcriptomics of Vaccine Therapy With or Without Cyclophosphamide in Treating Patients Undergoing Chemotherapy and Radiation Therapy for Stage I or Stage II Pancreatic Cancer That Can Be Removed by Surgery

  Pancreatic ductal adenocarcinoma (PDAC) is a rapidly progressing cancer that responds poorly to immunotherapies. Intratumoral tertiary lymphoid structures (TLS) have been associated with rare long-term PDAC survivors, but the role of TLS in PDAC and their spatial relationships within the context of the broader tumor microenvironment remain unknown. Here, spatial transcriptomics data were generated from 16 pancreatic cancer patients treated with GVAX, whose tumors presented with induced intratumoral TLS. Resected tumor specimens were embedded in OCT media and freshly frozen. Sections were cut into 6.5 x 6.5 mm dimensions compatible with Visium spatial transcriptomics slides. TLS-positive tumor sections from 14 patients (14 tumor samples in total) and lymph nodes from remaining patients (2 lymph node samples in total) were selected by an expert pathologist for profiling. We used 4 Visium slides and covered the 16 capture areas with sections cut in a cryostat at 10 µm. The fresh frozen Visium protocol was followed according to manufacturer's recommendations (10x Genomics Spatial 3' v1). Tissue permeabilization and library construction was carried out according to the manufacturer's protocols. Permeabilization time was optimized to 30 minutes. The captured tissue sections were permeabilized to allow RNA to be captured onto the slide where it reverse-transcribed to cDNA. The cDNA was then amplified, and sequencing libraries were prepared using the 10x Genomics Visium Spatial Gene Expression Reagent Kit for Library Preparation. The libraries were then sequenced using an Illumina NovaSeq sequencer. The raw data obtained from the sequencing were processed using the SpaceRanger (spaceranger-1.2.0) pipeline for alignment onto the GRCh38-2020-A reference transcriptome quantification of gene expression. Unsupervised learning generated a TLS-specific spatial gene expression signature that significantly associates with improved survival in PDAC patients. These analyses demonstrate TLS-associated intratumoral B cell maturation.

  Study phs003862

• Developing Targeted Therapy for Patients with Multiple Myeloma and Gain or Amplification of Chr1q (1q+)

  Multiple myeloma (MM) frequently presents with gain or amplification of chr1q (1q+), which is associated with inferior response to treatment and poor outcomes. To develop targeted therapy for MM with 1q+, we leveraged external and in-house dependency screens and drug screens, along with single-cell sequencing of patient tumors with subclonal 1q+. We demonstrated that MM with 1q+ exhibits higher sensitivity to MCL1 and PI3K inhibitors, which may be synergistic and act through established and novel mechanisms. Two human MM cell lines with 1q+, KMS12BM and KMS11, were profiled with either single-cell RNA-sequencing (scRNA-seq) alone (KMS12BM, KMS11) or both scRNA-seq and whole-genome sequencing (WGS; KMS12BM) to understand the factors that determine response to MCL1 and PI3K inhibitors and how these inhibitors work.

  Study phs003886

• Genomics Analysis Reveals Molecular Patterns of Tumorigenesis in HPV-Associated and HPV-Independent Sinonasal Squamous Cell Carcinoma

  The goal of this study was to identify molecular mechanisms of tumorigenesis in HPV-associated and HPV-independent sinonasal carcinoma using high-throughput sequencing approaches. Whole genome sequencing was performed for HPV-associated samples and whole exome sequencing for HPV-independent samples. Ultimately, we identified distinct molecular patterns of tumorigenesis between HPV-associated and HPV-independent disease. Data from patients for which informed consent allowed public sharing are included here.

  Study phs003591

• A Phase I Study of the Treatment of Recurrent Malignant Glioma with CAN-3110 (AKA rQNestin34.5v.2), a Genetically Engineered HSV-1 Virus

  This study is a "first-in-human" phase 1 trial of recurrent, IDH wild-type glioblastoma (rGBM) patients treated with CAN-3110 (aka rQNestin34.5v.2), a genetically modified oncolytic herpes simplex virus 1 (HSV-1). The study was a 3+3 dose-escalation study starting at a single intra-tumoral injection of 106 PFU CAN-3110 going up to 1010 PFU in half-log increments (cohorts 1-9). An expansion cohort (cohort 10) was treated with 109 PFU injected into up to 5 sites within a single tumor. Principal findings of the study conclude that:CAN-3110 was safe at all tested doses (no dose-limiting toxicities reached)HSV-1 seropositive patients survived significantly longer than HSV-1 seronegative patients in this study - longer than expected based on historical rGBM controlsHSV-1 seropositive patients were significantly more likely to clear CAN-3110 (HSV-1) antigen from their tumors based on immunohistochemical stainingCAN-3110 treatment-induced CD8+/CD4+ T-cell recruitment to injected tumor sites altered TCR beta diversity in both tumor infiltrating leukocytes (TILs) and PBMCs, and initiated changes in specific TCR beta clonotypes and immune gene signatures which were associated with post-treatment survival.Data provided in dbGaP for this study include:Bulk RNA-Seq data for 13 pre/post-treatment pairs of rGBM tumors corresponding to 12 unique patients (patient 28 was treated with CAN-3110 at two different timepoints). This data is provided as raw sequencing reads (.fastq), kallisto pseudoalignment transcript-level read counts (abundance.tsv files), gene-level abundance matrix (Gene_Level_Expression_Matrix.tsv), and immune gene signature scores matrix (Immune_Gene_Signatures_Matrix.tsv). Sequencing was performed as paired 150bp sequencing on NovaSeq6000 S4 Illumina flow cells. Library preparation varied by batch as described in the included RNAseq_Metadata.xlsx table.TCR beta DNA sequencing performed by Adaptive Biotechnologies for 21 pre/post-treatment pairs of rGBM tumors and PBMCs representing 20 unique patients (patient 28 was treated with CAN-3110 at two different timepoints). Note that all tumor pairs with TCR beta sequencing data also have available bulk RNA-Seq data. The TCR beta sequencing data is provided as an excel spreadsheet (TCRbeta_Sample_Overview.xslx), which provides a broad level summary of the sequencing on a per-sample basis (# of TCRbeta templates, T cell fraction, TCR beta diversity metrics, etc.) and as a large tab separated value file (Full_TCRbeta_Rearrangement_Details.tsv), which provides information per sample at the level of each unique TCR beta sequence (amino/nucleic acid sequence, VDJ gene usage, etc.).An excel table of de-identified metadata for the patients involved in this study.

  Study phs003378

• Integrated Somatic and Germline Molecular Properties Dictating Biological and Clinical Phenotypes in Cancer

  We performed single-nuclei matched RNA- and ATAC-sequencing of frozen biopsies from normal adjacent tissue, primary and metastatic esophageal adenocarcinoma specimens. The data was then further stratified into a tumor microenvironment and malignant compartment and was computationally analyzed to reveal cancer cell subtypes and programs driving malignancy.

  Study phs003438

• Addiction of Primary Cutaneous Gamma-Delta T-cell Lymphomas to JAK-STAT Signaling

  Primary cutaneous γδ T-cell lymphoma (PCGDTL) is a mature T-cell lymphoma (TCL) of the skin with a median survival of 31 months and no effective therapies. PCGDTLs frequently possess mutations in the JAK/STAT pathway, including in JAK1, JAK3, STAT3, STAT5B, and SOCS1. We hypothesized that single-agent JAK inhibition may be effective in PCGDTLs, particularly those with targetable JAK/STAT pathway mutations. Herein, we demonstrate the near-complete response of two PCGDTL cases to single-agent JAK inhibitors, ruxolitinib or cerdulatinib. However, both patients eventually relapsed with acquired mutations in JAK1, JAK3, or STAT5B.

  Study phs003837

• Immune-Related Adverse Events after Immune Checkpoint Blockade-Based Therapy are Associated with Improved Survival in Advanced Sarcoma

  Immune activation after immune checkpoint blockade (ICB) can lead to a unique group of adverse events (AEs), which have been associated with improved outcome in many carcinomas. The association between immune-related AEs (irAEs) and outcome in patients with sarcoma is not well studied. This study has two components: (1) a retrospective clinical study of irAEs among 131 patients treated with ICB at Memorial Sloan Kettering Cancer Center and (2) an analysis of a subset of these patients who have whole transcriptome sequencing available for analysis. In the clinical study portion, we reviewed a cohort of patients with advanced sarcoma treated on prospective clinical trials utilizing ICB-based therapy between April 2017 and January 2020. The objectives were to pool the safety data from each trial, identify irAEs, and correlate them with best overall response by RECIST 1.1, progression-free survival (PFS) and overall survival (OS). Association of irAEs with response and survival was assessed using a Cox regression model. A total of 131 patients were included. Forty-two (32%) had at least one irAE of any grade and 16 (12%) had at least one Grade ≥ 3 irAE. On Cox analysis adjusting for clinical covariates that were significant in the univariate setting, the hazard ratio (HR) for an irAE (HR 0.662, 95% CI 0.421 - 1.041) approached, but did not reach statistical significance for PFS (P = 0.074), while patients had a significantly lower HR for OS (HR 0.443, 95% CI 0.246 – 0.798; P = 0.007) compared to those without or before an irAE. Tumor samples with available RNA sequencing data were stratified by presence of an irAE to identify patterns of differential gene expression. In total, 71 unique patients had RNA sequencing available for analysis. The transcriptomes of 31 of these patients have been previously uploaded to dbGaP (phs002852), leaving 36 unique transcriptomes that have not been previously publicly shared. Three patients did not agree for their sequencing to be publicly shared. Therefore, 33 unique patient samples will be uploaded to this dbGaP study. Overall, this study found that gene expression profiling on baseline tumor samples from patients who had an irAE had higher numbers of tumor-infiltrating dendritic cells, CD8+ T cells, and regulatory T cells as well as upregulation of immune and inflammatory pathways.

  Study phs003284

• Multi-Omic Investigation of Beckwith-Wiedemann Syndrome Hepatoblastoma

  Hepatoblastoma (HB) is the most common malignant liver tumor diagnosed in children under 5 years of age. One of the most common HB predisposition syndromes is Beckwith-Wiedemann Syndrome (BWS, OMIM 130650), which affects approximately 1/10,000 live births. In this study, we perform Whole Exome Sequencing (WES), DNA methylation array, messenger RNA-Sequencing (mRNA-Seq), and microRNA-Sequencing (miRNA-Seq) to examine the genomic, methylomic, and transcriptomic signature of BWS HB. We analyzed five tumor-normal paired samples, two BWS tumor only samples, and five non-BWS control samples to identify a predisposition and oncogenic signature of BWS HB development. To further understand the new impact of 11p15 changes, specifically in the liver, we performed single-nucleus RNA sequencing (snRNA-seq) and single-nucleus assay for transposase-accessible chromatin with sequencing (snATAC-seq) to generate paired, cell-type-specific transcriptional and chromatin accessibility profiles of both BWS-liver and nonBWS-liver nontumorous and tumor tissues.

  Study phs002614

• DAC_RNA-seq of murine osteosarcoma cell line genetically modified for CYR61

  Data access committee for RNA-seq of murine osteosarcoma cell line genetically modified for CYR61

  Dac EGAC50000000352

• "IL-17A-Producing ILC3s and Duodenal Adenoma in FAP"

  Dac EGAC00001003301

• Immune Determinants of Resistance to PD-1 Blockade in Renal Cell Carcinoma

  We performed an integrated bulk and single-cell transcriptomic analysis of tumors from 102 advanced renal cell carcinoma patients enrolled in a phase II clinical trial of frontline nivolumab (NCT03117309) to investigate determinants of response to anti-PD1 monotherapy. The present study includes 112 archival or pre-treatment tumors of clear cell and non-clear cell histologies from 90 patients that underwent bulk RNA sequencing (RNA-seq). For 76 patients, 74 of whom had matched RNA-seq, whole exome sequencing (WES) was also performed on tumor samples as well as matched peripheral blood. Additionally, 19 fresh tumor samples from 17 patients, including pre and post-treatment samples and mixed histologies, were locally cryopreserved and centrally processed for single cell RNA (scRNA-seq) and TCR (scTCR-seq) sequencing. 7 patients had matched scRNA/scTCRseq, RNAseq, and WES.

  Study phs003618

• Aberrant RNA-splicing (neojunctions) offers a new source for targets, and our neoantigen discovery platform (SNIPP) characterizes a novel class of clonally-expressed splicing-derived neoantigens that elicit a CD8+ T-cell-mediated tumor killing response.

  RESULTS: Our pipeline identified 789 public neojunctions, with 32 neojunctions concurrently identified in transcriptomic and proteomic glioma data and predicted to be presented by HLA-A*02:01 with high confidence. IVS and subsequent 10x VDJ scRNA-seq identified TCR clonotypes reactive against neojunctions in RPL22 (n=7) and GNAS (n=1), the latter being highly intratumorally-conserved (detected in > 90% of spatially-mapped biopsies across 17/56 patients (26.78%)). TCR-transduced T-cells demonstrated recognition and immunogenic activation against endogenously processed and presented neoantigens in multiple GBM PDX cell lines. Furthermore, IDH1-mutant oligodendroglioma samples demonstrated significantly elevated expression of neojunctions over IDH1-mutant astrocytoma and IDH1wt subtypes. Differential gene expression (DESeq2) identified decreased expression of splicing factors due to oligodendroglioma-specific co-deletion of Chromosomes 1p/19q. siRNA knockdown of these splicing factors (e.g. SF3A3, SNRPD2) in IDH1wt glioma cells resulted in significantly increased expression of corresponding neojunctions.

  Study EGAS00001007986

• DNA Methylation in Prostate Tumor and Paired Benign Tissue for African and European Ancestry Men

  We recruited prostate cancer (PCa) patients undergoing robotic-assisted laparoscopic radical prostatectomy at the University of Chicago Medical Center Urology Clinic between 2011 and 2017. Our study includes 76 African American (AA) and 75 European American (EA) men with PCa of Gleason Score (GS) ≥7, recruited by the Epidemiology Research Recruitment Core at the University of Chicago. All patients consented to the collection of questionnaire data, prostate tissue, and medical records. The study was approved by the Institutional Review Board of the University of Chicago. Following prostatectomy, prostate tissue was sent to the Human Tissue Research Center (HTRC) at the University of Chicago. Each sample underwent histological examination and Gleason scoring by University of Chicago genitourinary pathologists. The presence of adenocarcinoma was confirmed by overexpression of alpha-methylacyl-coenzyme-A racemase (AMACR) and areas for DNA extraction were marked. Tissue samples used for DNA extraction were obtained using with either a 1mm biopunch or laser microdissection of a 100 µm2 area of tissue. Genome-wide DNA methylation profiles were generated using Illumina's Infinium MethylationEPIC BeadChip array kit. Genome-wide SNP data was generated (from benign tissue DNA) using the Illumina Infinium Multi-Ethnic Global-8 v1.0 array at the University of Chicago Genomics Core Facility. We performed imputation using the Haplotype Reference Consortium (HRC, Version r1.1 2016) panel, which includes all samples from the 1,000 Genomes Project (Phase 3), using the Michigan Imputation Server. The imputed SNP data for mQTL analysis was imputed based on genotype SNP data which was all from benign tissue DNA and the methylation data was identified in both tumor and benign tissue, both AA and EA men, and identified QTLs co-occuring with prostate cancer susceptibility loci.Data including SNP genotypes, DNA methylation, tissue type, and participant characteristics will be available in dbGaP.

  Study phs003516

• Depth of Response Correlates with Improved Outcomes for Early Interception in a High-Risk Smoldering Multiple Myeloma Clinical Trial Using the Combination of Ixazomib, Lenalidomide, and Dexamethasone

  Early treatment of patients with high-risk smoldering myeloma (HRSMM) has been shown to delay progression to multiple myeloma (MM), but not all patients respond well. Identifying biological predictors of response and resistance to treatment can help optimize treatment selection for patients and improve outcomes. Here, we investigate tumor and immune biomarkers of response to ixazomib, lenalidomide, and dexamethasone treatment (I-PRISM study) that can be measured at diagnosis. We performed single-cell RNA sequencing (scRNAseq), coupled with B cell receptor and T cell receptor sequencing, on CD138+ tumor and CD138- immune cells, respectively, from the bone marrow of 20 patients enrolled in the I-PRISM study.

  Study phs003827

• DAC for study involving the spatial transcriptomics analysis of HPV-dependent and HPV-independent vulval squamous cell carcinoma at Imperial College London.

  Dac EGAC00001003515

• ATAC-seq in KMS11 vs TKO cells

  ATAC-seq to determine chromatin accessibility in t(4;14) Myeloma cell line KMS11 and KMS11 cells with knock-out of the translocated NSD2 allele.

  Study EGAS50000000076

• ChIP-seq in KMS11 and TKO cells

  Histone chIP-seq in t(4;14) Myeloma cell line KMS11 and KMS11 cells with knock-out of translocated NSD2 allele (KMS11 TKO).

  Study EGAS50000000077

• MicroC in KMS11 and TKO cells

  MicroC to show high resolution chromatin interactions in t(4;14) Myeloma cell line KMS11 and KMS11 cells with knock-out of translocated NSD2 allele (KMS11 TKO).

  Study EGAS50000000078

• Mutational Profile in Newly Diagnosed Diffuse Large B-Cell Lymphoma: Insights from the GAINED Study

  The GAINED study (NCT01659099) is a randomized phase 3 trial comparing obinutuzumab (G) to rituximab (R) in combination with ACVBP or CHOP14 induction, followed by PET-guided consolidation. This post-hoc analysis focuses on primary mediastinal B-cell lymphoma (PMBL) patients, confirmed through expert pathological review and characterized using gene-expression profiling (GEP) and Next-Generation Sequencing (NGS).

  Dac EGAC50000000540

• Mayo Clinic Adult Diffuse Glioma Illumina OncoArray SNP Data

  These data are from adult diffuse glioma subjects genotyped on the Illumina OncoArray. Data from this study were used for case control association studies and developing polygenic risk scores. Variants in D2HGDH and near FAM20C were identified that were associated with glioma subtypes (PMID: 32386320). Mutation and copy number data are included for select genes and chromosomes. IDH mutation and 1p/19q co-deletion are used in glioma diagnosis and are also prognostic markers. Data for additional prognostic genes and chromosomes are also included. RNA-seq and CHIP-seq data are available for select subjects from this cohort in GEO (GSE167806).

  Study phs003041

• Genomic Landscape of Multiple Myeloma and of its Precursor Conditions, and its Clinical Implications

  Reliable strategies to capture patients at risk of progression from precursor stages of multiple myeloma (MM) to overt disease are still missing. In this study, we generated whole-genome sequencing (WGS) data from matched tumor and normal samples from 98 individuals from the PCROWD study (Precursor Crowd, NCT02269592). These individuals have either a precursor condition for MM, which can be a monoclonal gammopathy of undetermined significance (MGUS) or smoldering multiple myeloma (SMM), or an active multiple myeloma (MM). To do so, we enriched tumor plasma cells from the bone marrow by magnetic bead selection (CD138+), sequenced the DNA of these samples to a target depth of 60X (tumor), and analyzed them against normal white blood cells (peripheral blood mononuclear cells) from the same individuals sequenced to a target depth of 30X (normal). In our first publication [Alberge, Dutta, Poletti, et al., 2025], we integrated and homogeneously analyzed these data together with data from mostly publicly available datasets (phs003084 and phs000748) to reach 1,030 total samples. We used these data to identify recurrent coding and non-coding candidate drivers, as well as significant hotspots of structural variation, and used those drivers to define and validate a simple “MM-like” score which we could use to place patients' tumors on a gradual axis of progression toward active disease. Our MM precursor genomic map provides new insights on the time of initiation and cell of origin of the disease, on the order of acquisition of genomic alterations, and on mutational processes found across stages of the transformation. Taken together, we highlight here the potential of genome sequencing to better inform risk assessment and monitoring of MM precursor conditions.

  Study phs003846

• Efficacy and Immune Effects of Anakinra Prophylaxis for Neurologic Toxicity and Cytokine Release Syndrome in Patients with Lymphoma Receiving Axicabtagene Ciloleucel

  Chimeric antigen receptor T cells have transformed the treatment of multiple hematologic malignancies, but are limited in application due to treatment-related toxicities. Cytokine release syndrome (CRS) and neurotoxicity (NT) are the primary toxicities associated with these therapies and are thought to be mediated by broad immune activation due to robust T-cell expansion. Current treatment of these toxicities utilize anti-IL-6 directed therapy and/or systemic glucocorticoids to mitigate the consequences of this complex inflammatory cascade. We sought to use anakinra, an IL-1R antagonist, as a prophylactic strategy to prevent clinically meaningful CRS/NT, defined as grade 2 or higher toxicity necessitating clinical intervention. Although our study, in line with others, demonstrated that IL-1R antagonism is insufficient to prevent such toxicities entirely, we were able to gain insight into the molecular immune signaling associated with breakthrough CRS & NT in the presence of anakinra prophylaxis using our scRNA dataset of patients treated with and without IL-1R antagonism. We demonstrate that IL-4 and IL-10 anti-inflammatory pathways in infused CAR-T products of both anakinra and non-anakinra cohorts were negatively associated with grade 2+ toxicities. We also found that expression of IFN-gamma pathways and ligand-receptor activities, as well as cytokine levels of IFN-gamma and CXCL10 in CD14+ monocytes, were significantly enriched in patients with breakthrough toxicity in the anakinra cohort. This correlated with an increase in IFN-gamma in the peripheral blood of patients with breakthrough toxicities, among other cytokines. These data identify IFN-gamma as a potential key mechanism in the development of CAR-T cell-associated toxcities and suggest that this pathway is also targetable and not inhibited by anakinra alone.

  Study phs003655

• Whole Exome Sequencing of Diffuse Large B-Cell Lymphoma

  We performed massively parallel whole exome sequencing of 55 primary tumor samples from patients with diffuse large B cell lymphoma (DLBCL) and matched normal tissue. We identified recurrent mutations in genes that are well known to be functionally relevant in DLBCL, as well as in genes for which a functional role in DLBCL has not been previously suspected. Significantly mutated genes include MYD88, CARD11, EZH2, CREBBP, as well as MEF2B, MLL2, BTG1, GNA13, ACTB, P2RY8, PCLO and TNFRSF14. Analysis of somatic mutations in patients with DLBCL also revealed that BCL2 mutations commonly occur in patients with BCL2/IgH rearrangements as a result of somatic hypermutation normally occurring at the IgH locus. The BCL2 point mutations are primarily synonymous, likely caused by activation-induced cytidine deaminase (AID)-mediated somatic hypermutation, and those non-synonymous mutations that are observed tend to be found outside of the functionally important BH domains of the protein, suggesting that strong negative selection against BCL2 loss-of-function mutations is at play. We further identified genes with mutations that are likely to be functionally relevant despite being mutated at a low rate. These genes include KRAS, BRAF and NOTCH1 as likely drivers of DLBCL pathogenesis in some patients.In order to facilitate additional in vitro and in vivo analyses of the discrete molecular clusters and associated targeted therapies in preclinical models, we also performed our subtyping analysis on 28 Diffuse Large B-Cell Lymphoma (DLBCL) cell lines. We performed whole exome sequencing (WES) on these cell lines to capture structural variants (SVs), from which we obtained full genetic characterization and segregation of these cell lines into our previously defined molecular clusters by DLBclass assignment. These analyses are available in an interactive DLBclass portal available to the public. Our data provide an unbiased view of the landscape of mutations in DLBCL. These data may point towards new targets for the treatment of DLBCL.

  Study phs000450

• IDH mutant Glioma methylation analysis and prognostic signatures

  Study EGAS00001006961

• Multiple Myeloma Clinical Targeted Sequencing of Patient Samples

  Purpose: Molecular diagnostics for the risk stratification of patients with multiple myeloma (MM) have languished in the area of cytogenetics and fluorescence in situ hybidization (FISH). However, here we present the case for next generation sequencing of MM patient samples to not only identify high-risk markers, but also mutations and deletions relating to immunomodulatory drugs (IMiDs), and more importantly to guide the sequencing of immunotherapy regimens in response to intrinsic antigen escape as a means of treatment resistance and relapse. Experimental design: CD138+ cell selected samples (n=134) from bone marrow aspirates from patients with multiple myeloma were sequenced using a targeted panel in a clinical diagnostics laboratory. Data were analyzed for high-risk markers, treatment-related resistance mechanisms, and precision medicine targets to guide the future treatment of patients in the clinic. Results: High-risk markers including t(4;14), t(14;16), t(14;20), gain or amplification 1q, deletion of CDKN2C, and deletion or mutation of TP53 were identified in 15% of newly diagnosed myeloma patient samples. At relapse, alterations in the cereblon degradation pathway were found in 24.3% of IMiD treated patients. Deletions of 4p (CD38) were also enriched in patients who received anti-CD38 treatment (P=0.03) which were mostly monoallelic. Deletions and mutations were detected in TNFRSF17 encoding BCMA in patients treated with anti-BCMA regimens, and the information was used to change the treatment of the patients. Conclusions: Targeted sequencing of multiple myeloma patient diagnostic samples can be used for risk stratification, and also to monitor and adjust treatments as resistance mechanisms evolve.

  Study phs003908

• MP2PRT-MNG: Identifying Novel Molecular Markers of Response to Radiotherapy in Meningiomas Using Samples from the RTOG-0539 (NCT00895622)

  The Molecular Profiling to Predict Response to Treatment (MP2PRT) program is part of the NCI's Cancer Moonshot Initiative. The aim of this program is the retrospective characterization and analysis of biospecimens collected from completed NCI-sponsored trials of the National Clinical Trials Network and the NCI Community Oncology Research Program. NRG RTOG (Radiation Therapy Oncology Group)-0539, which was a nonrandomized phase II cooperative group trial in 2009, was selected for inclusion in this program. NRG RTOG-0539 assigned patients with histologically confirmed diagnosis of meningioma to 1 of 3 risk groups based on 2007 WHO grade, resection extent, and recurrence status, and radiotherapy was given per protocol to the intermediate- and high-risk cases. Under the MP2PRT program, DNA methylation profiling, RNA sequencing, and whole exome sequencing were performed on clinical trial cases with available tissue for molecular analyte extraction and subsequent sequencing. Raw molecular data with metadata are available for this study.

  Study phs003707

• Targeting EGFR in NF1 Mutant Melanoma

  Our study focused on melanoma patients with driver mutations in the neurofibromin 1 (NF1) tumor suppressor gene, a subset of melanoma patients that have not benefitted from recent treatment advances. We have leveraged patient-derived short-term cultures (STCs) and multiomics approaches to identify molecular features that could be developed into therapies for NF1 mutant melanoma patients. Our studies revealed that the epidermal growth factor receptor (EGFR) is highly expressed and active in NF1 mutant melanoma cells, and that genetic or pharmacological EGFR inhibition impaired tumor cell proliferation, survival, and cell growth in patient-derived NF1 mutant but not NF1 wild-type melanoma models.

  Study phs003906

• Immediate Postoperative Minimal Residual Disease Detection with MAESTRO Predicts Recurrence and Survival in Head and Neck Cancer Patients Treated with Surgery

  We selected 24 patients with locally advanced head and neck squamous cell carcinoma (HNSCC) who were surgically treated. MAESTRO, our ultrasensitive, tumor-informed, mutation enrichment sequencing assay, was applied in a pooled format (MAESTRO-Pool) to plasma samples collected from these patients at baseline (pre-op) and postoperatively. We show that detection of circulating tumor DNA (ctDNA) 1 to 9 days after surgery is associated with significantly worse survival. Many plasma samples also had tumor fractions detected below 100 parts-per-million, the detection limit for first-generation commercial assays, highlighting the need for more sensitive ctDNA assays. Here we provide whole genome sequencing of matched tumor biopsy and normal germline DNA from 24 patients that were used to identify somatic single nucleotide variants (SNVs) to be tracked using our MAESTRO-Pool assay.

  Study phs003981

• SPECIAL (scATACseq): Dissecting the melanoma ecosystem one cell at the time during immunotherapy

  Characterising epigenome profiles of stage III/IV melanoma samples treated with ICB before and on treatment by single cell ATAC sequencing.

  Study EGAS50000001014

• Dac for "Development of a fully human glioblastoma-in-brain-spheroid model for accelerated translational research"

  This is the DAC for "Development of a fully human glioblastoma-in-brain-spheroid model for accelerated translational research" of Philipp Koch (philipp.koch@zi-mannheim.de), Frank Winkler (Frank.Winkler@med.uni-heidelberg.de), Moritz Mall( m.mall@dkfz-heidelberg.de)

  Dac EGAC50000000480

• Functional Variant rs9344 at 11q13.3 Regulates CCND1 Expression in Multiple Myeloma with t(11;14)

  Multiple myeloma (MM) is a plasma cell (PC) malignancy characterized by cytogenetic abnormalities, such as t(11;14)(q13;q32), resulting in CCND1 overexpression. The rs9344 G allele within CCND1 is the most significant susceptibility allele for t(11;14). We have found the G risk allele is enriched in both healthy individuals of African ancestry and African American individuals with MM. The overall aim of this study was to identify the mechanism behind why the G allele is enriched in t(11;14) MM. To reach this goal, we performed ATAC-seq from 100,000 CD138+ tumor cells from 26 patients with MM. In addition, we performed ChIP-seq using antibodies against H3K4me1, H3K27ac and H3K4me3 from 100,000 CD138+ tumor cells from 8 patients with MM. We used these data to evaluate whether the G allele of rs9344 is associated with elevated chromatin accessibility, H3K27ac and H3K4me3 in t(11;14) MM.

  Study phs003997

• Single-Cell Mitochondrial Mutation Lineage Tracing of Non-Dysplastic and Dysplastic Barrett's Esophagus

  This study addresses a critical knowledge gap in understanding Barrett's esophagus (BE), a common metaplastic condition and precursor to esophageal adenocarcinoma, by identifying lineage connections and cell states underlying its development and malignant transformation. We collected biopsies from 13 Barrett's esophagus patients undergoing routine surveillance endoscopy, sampling metaplastic tissue alongside normal squamous esophagus and gastric cardia tissues when clinically appropriate. Our novel approach integrated single-cell RNA sequencing of nearly 180,000 cells with mitochondrial DNA mutation analysis for lineage tracing, coupled with spatial transcriptomics and comprehensive whole-exome sequencing. For one patient with high-grade dysplasia, we performed detailed whole-exome sequencing analysis at 100x coverage on dissociated Barrett's esophagus cells alongside matched normal esophagus and gastric cardia tissues. This genomic profiling revealed critical genetic drivers of malignant transformation, including a truncating mutation in the mutation cluster region of APC (a negative WNT regulator), mutations in the tumor suppressor genes CDKN2A and TP53, and significant copy number alterations including loss of CDKN2A on chromosome 9. These genetic alterations corresponded with the transcriptional changes observed in our single-cell data, particularly WNT pathway dysregulation and the expansion of LGR5-expressing stem cells, providing molecular evidence for how single clones can initiate the dysplastic transformation. Data deposited in dbGaP consist specifically of the whole-exome sequencing raw files, processed variant calls, and copy number analyses from the single patient with high-grade dysplasia and matched normal esophagus and stomach control tissue. Whole exome sequencing was performed on an Illumina NovaSeq 6000. Sequencing data was preprocessed following the Genome Analysis Toolkit's (GATK) Best Practices. Sequencing data was analyzed with Mutect2 (GATK, v4.2.5.0) to identify short somatic mutations including single-nucleotide polymorphisms and insertions and deletions. The Barrett's esophagus sample was run with the two matched normals, as well as the publicly available germline resource somatic-hg38_af-only-gnomad.hg38.vcf.gz (GATK). Somatic variant calls were filtered using FilterMutectCalls (GATK) and loaded into the Integrative Genomics Viewer (v2.12.3) for identification of high-quality variants in known esophageal adenocarcinoma regulators. Copy number alterations in the Barrett's esophagus sample were estimated using CNVkit (v0.9.9). CNV, Mutect2, and SVC analyses will be made available through dbGAP. Copy number alterations in the Barrett's esophagus sample were estimated using CNVkit (v0.9.9) with the default run settings; a pooled reference was generated from the normal esophagus and stomach samples. Copy number results were plotted directly within CNVkit using the function scatter.

  Study phs003949

• P4HA1 Mediates Hypoxia-Induced Invasion in Human Pancreatic Cancer Organoids

  Pancreatic ductal adenocarcinoma (PDAC) is an aggressive malignancy defined by extensive invasion into the local tumor microenvironment and systemic metastasis. PDAC develops in a hypoxic microenvironment and adapts to survive under low oxygen conditions, including the activation of processes that may enhance the ability of cancer cells to invade locally or metastasize. Here we employ bulk RNA-sequencing of eight patient-derived organoid (PDO) cultures grown in hypoxia and normoxia to identify differentially expressed genes. PDOs were grown in Matrigel, transferred into collagen domes, then incubated in hypoxia or normoxia. Invasive organoids were individually collected from collagen domes grown in hypoxia and normoxia separately and processed for RNA-sequencing analysis. Using this dataset, prolyl 4-hydroxylase subunit alpha (P4HA1) was identified as a potential regulator of PDAC invasion in hypoxia. This dataset exists as a reference for gene expression of invasive organoids in hypoxia and normoxia.

  Study phs003961

• Multi-omics profiling identifies two epithelioid sarcoma molecular subtypes with distinct signaling and immune characteristics

  Epithelioid sarcoma (EpS) is an aggressive sarcoma, characterized by the loss of SMARCB1 expression. EpS is traditionally classified as distal or proximal according to clinicopathological features, but its molecular characteristics remain largely unknown. To establish an EpS molecular classification and uncover determinants of inter- and intra-patient heterogeneity in EpS, we used multi-omics profiling and integrated the genomic, transcriptional and methylome landscapes with single-cell RNA sequencing on fresh samples as well as spatial transcriptomics. We identified two molecular subtypes of EpS: “distal-like” and “proximal-like”, which were distinct from the histological subtypes. Distal-like tumors include all morphological distal subtypes and a subset of proximal and hybrid EpS. They express a specific molecular single-cell derived epithelial-to-mesenchymal transition signature, which associates with improved patient survival and includes Desmoglein 2 (DSG2), which we identify as a potential routine immunohistochemical biomarker to improve diagnosis. Distal-like EpS also display increased peri-tumoral CD8+ T cell infiltrates and specific tumor-immune cell interactions. Conversely, proximal-like EpS harbor a higher inter-tumoral molecular heterogeneity with some cases resembling other SMARCB1-deficient tumors by DNA methylation profiling, and increased intra-tumoral pro-tumoral macrophage infiltrates. Our study introduces a novel molecular classification of EpS with prognostic value, associated diagnostic biomarkers and distinct tumor immune microenvironments, which extends beyond traditional clinicopathological classification. This paves the way for precision medicine-based therapeutic strategies for patients with EpS.

  Dac EGAC50000000552

• Childhood Cancer Data Initiative (CCDI): Pediatric In Vivo Testing Program –Sarcoma, Kidney, and Liver Cancers

  The goal was to complete whole exome sequencing (WES) and RNA sequencing (RNA-Seq) on patient derived xenograft samples. Cancer in children is rare with approximately 15,700 new cases diagnosed annually in children 21 years or younger in the U.S. Through use of multimodality therapy (surgery, radiation therapy, and aggressive chemotherapy), 70% of patients will be 'cured' of their disease, and 5-year Event-Free Survival (EFS) exceeds 80%. Consequently, the number of patients that can be enrolled in phase I/II clinical trials is small, and most patients will have been extensively treated, hence drug/radiation resistant. Thus, preclinical studies that accurately translate into effective clinical therapy are an essential component of pediatric drug development. Our group has contributed to studies in the Pediatric Preclinical Testing Program (PPTP) and Pediatric Preclinical Testing Consortium (PPTC) that have led to clinical studies through Children's Oncology Group (COG). Of importance, we have developed and characterized over 330 Patient Derived Xenografts (PDX), developed from tumors both at diagnosis and relapse, that can be used to facilitate pediatric drug development as directed by FDA under the Research to Accelerate Cures and Equity for Children Act (RACE for Children Act).

  Study phs003160