10670 results for "800k fc coins Navštivte Buyfc26coins.com Speciální balíčky na prázdniny a dovolené..dQVy"

in 17.31 milliseconds.

• Blood neutrophils in COPD derive from activated progenitors in the bone marrow

  Chronic obstructive pulmonary disease (COPD) is a major respiratory disease characterized by small airway inflammation, emphysema and severe breathing difficulties. Low-grade systemic inflammation is an established hallmark of severe disease, however, the molecular changes in peripheral immune cells remain far from understood. We combined multi-color flow cytometry with single-cell RNA sequencing and showed that blood neutrophil numbers are significantly increased in COPD and they are a heterogeneous population. A transcriptomic state that expressed interferon response genes correlated with alveolar damage and acute exacerbations. Furthermore, bronchoalveolar neutrophils expressed gene signatures corresponding to certain blood neutrophil states. Last, our data in a murine model of cigarette smoke exposure demonstrated that bone marrow neutrophil progenitors are expanded in smoke-treated animals and display signs of immune activation. Our study provides evidence that COPD systemic inflammation may derive from an activated haematopoietic precursor compartment.

  Dataset EGAD00001008788

• Targeted DNA panel sequencing analysis of PanNEN tumors of varying grades using custom and commercial panels

  Targeted panel sequencing data from PanNEN samples. Sample ID is annotated in the following manner: each patient is given a number and "P" is appended to the patient number if it is a primary tumor, "M” if it is metastasis and "N" if it is normal (healthy tissue) sample. All NETG1 and NETG2 samples underwent panel sequencing using a custom panel (in-house PanNEN panel). All NEC and NETG3 samples (except PNET2, PNET77P and PNET77M) underwent panel sequencing using a commercial CCP panel.

  Dataset EGAD00001008432

• Blood neutrophils in COPD derive from activated progenitors in the bone marrow sc Seqwell

  Chronic obstructive pulmonary disease (COPD) is a major respiratory disease characterized by small airway inflammation, emphysema and severe breathing difficulties. Low-grade systemic inflammation is an established hallmark of severe disease, however, the molecular changes in peripheral immune cells remain far from understood. We combined multi-color flow cytometry with single-cell RNA sequencing and showed that blood neutrophil numbers are significantly increased in COPD and they are a heterogeneous population. A transcriptomic state that expressed interferon response genes correlated with alveolar damage and acute exacerbations. Furthermore, bronchoalveolar neutrophils expressed gene signatures corresponding to certain blood neutrophil states. Last, our data in a murine model of cigarette smoke exposure demonstrated that bone marrow neutrophil progenitors are expanded in smoke-treated animals and display signs of immune activation. Our study provides evidence that COPD systemic inflammation may derive from an activated haematopoietic precursor compartment.

  Dataset EGAD00001008908

• Blood neutrophils in COPD derive from activated progenitors in the bone marrow sc Rhapsody

  Chronic obstructive pulmonary disease (COPD) is a major respiratory disease characterized by small airway inflammation, emphysema and severe breathing difficulties. Low-grade systemic inflammation is an established hallmark of severe disease, however, the molecular changes in peripheral immune cells remain far from understood. We combined multi-color flow cytometry with single-cell RNA sequencing and showed that blood neutrophil numbers are significantly increased in COPD and they are a heterogeneous population. A transcriptomic state that expressed interferon response genes correlated with alveolar damage and acute exacerbations. Furthermore, bronchoalveolar neutrophils expressed gene signatures corresponding to certain blood neutrophil states. Last, our data in a murine model of cigarette smoke exposure demonstrated that bone marrow neutrophil progenitors are expanded in smoke-treated animals and display signs of immune activation. Our study provides evidence that COPD systemic inflammation may derive from an activated haematopoietic precursor compartment.

  Dataset EGAD00001009704

• Metabolic reprogramming towards OXPHOS identifies a novel therapeutic target for mantle cell lymphoma

  Metabolic reprogramming is linked to cancer cell growth and proliferation, metastasis, and therapeutic resistance in a multitude of cancers. Targeting dysregulated metabolic pathways to overcome resistance, an urgent clinical need in all relapsed/refractory cancers, remains difficult. Through genomics analysis of clinical specimens, we show that metabolic reprogramming towards oxidative phosphorylation (OXPHOS) and glutaminolysis is associated with therapeutic resistance to the Bruton’s tyrosine kinase inhibitor ibrutinib in mantle cell lymphoma (MCL), an incurable B-cell lymphoma with poor clinical outcomes. Inhibition of OXPHOS with a novel, clinically applicable small molecule, IACS-010759, which targets complex I of the mitochondrial electron transport chain, results in significant growth inhibition in vitro and in vivo in ibrutinib-resistant patient-derived cancer models. This work suggests that targeting metabolic pathways to subvert therapeutic resistance is a clinically viable approach to treat highly refractory malignancies.

  Dataset EGAD00001004577

• The landscape of somatic mutation in normal colorectal epithelial cells

  The colorectal adenoma-carcinoma sequence has provided a paradigmatic framework for understanding the successive somatic genetic events and consequent clonal expansions leading to cancer. As for most cancer types, however, understanding of the earliest phases of colorectal neoplastic change, which may occur in morphologically normal tissue, is comparatively limited because of the difficulty of detecting somatic mutations in normal cells. Each colorectal crypt is a small clone of cells derived from a single recently-existing stem cell. Here, we sequenced hundreds of normal crypts from 42 individuals. Signatures of multiple mutational processes were revealed, some ubiquitous and continuous, others only found in some individuals, in some crypts or during some phases of the cell lineage from zygote to adult cell. Likely driver mutations were present in ~1% of normal colorectal crypts in middle-aged individuals, indicating that adenomas and carcinomas are rare outcomes of a pervasive process of neoplastic change across morphologically normal colorectal epithelium.

  Dataset EGAD00001004193

• Chromosome Segregation Errors Promote a Diverse Spectrum of Simple and Complex Genomic Rearrangements

  Cancer genomes are frequently characterized by numerical and structural karyotypic abnormalities. Here we combined an inducible centromere-specific inactivation approach with selection for a conditionally essential gene, a strategy we term ‘CEN-SELECT’, and show that single-chromosome missegregation during cell division can directly drive a broad spectrum of structural rearrangement types. Cytogenetic profiling revealed that missegregated chromosomes are 120-fold more susceptible to developing seven major categories of structural variants, including translocations, insertions, deletions, and reassembly into chromothriptically rearranged chromosomes. Whole-genome sequencing of clones with genetically propagatable derivative chromosomes identified complex rearrangements and copy-number alterations that can result in gene inactivation or extrachromosomal gene amplification. We conclude that chromosome segregation errors are sufficient to drive extensive structural variation that recapitulates those commonly associated with human cancers.

  Dataset EGAD00001004163

• Next Generation Sequencing in an IBD Pedigree Whole Genome Data

  In 2009 we identified a four-generation family with over 700 members and 41 affected with Crohn's disease (CD). At the time we sequenced the exome of 6 affected individuals but did not identify any coding variants which appear to explain the high prevalence of disease. Since then we have collected DNA from a large number of additional family members, genotyped linkage arrays on the entire family to refine genomic regions shared by identity by descent and genotyped affected and unaffected members at known CD risk loci identified by Genome Wide Association Studies (GWAS). These analyses have confirmed that a significant unexplained excess of disease remains after accounting for all known genetic factors, and that several regions of the genome are shared by a large fraction of affected individuals. We therefore perform whole genomes sequencing from 8 individuals which will allow us to impute the complete sequence of nearly all the members of the two largest and most severely affected branches of the family.

  Dataset EGAD00001000399

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• Whole genome sequencing of Sinonasal hemangiopericytoma and patient derived cell line model

  Solitary fibrous tumor/Hemangiopericytoma (SFT/HPC) is a rare subtype of soft tissue sarcoma associated with NAB2-STAT6 gene fusions. In this study, a novel SFT/HPC was characterized using whole genome sequencing.

  Dataset EGAD50000000038

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Phenome-wide scanning identifies multiple diseases and disease severity phenotypes associated with HLA variants

  We discover numerous associations between human leukocyte antigen (HLA) variation and a comprehensive set of phenotypes derived from electronic health records.

  Study phs001949

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• BipEx_ODonovan_Cardiff

  "BipEx_EGAS000010058452_ODonovan_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000130

• BipEx_Craddock_Cardiff

  "BipEx_EGAS00001005845_Craddock_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,458 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000135

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131