10850 results for "800k fc coins Navštivte Buyfc26coins.com Speciální balíčky na prázdniny a dovolené..dQVy"

in 19.04 milliseconds.

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131

• BipEx_Ouwehand_Cambridge

  "BipEx_EGAS000010058454_Ouwehand_Cambridge Bipolar Disorder Exomes. This research project was a collaboration between Cambridge University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,873 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000138

• BipEx_Posthuma_Amsterdam

  "BipEx_EGAS00001005857_Posthuma_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between VU and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 943 Bipolar case/control samples from collaborators in the Netherlands. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000143

• scMultiome analysis of human tongue cancer organoids

  We performed single-cell Multiome analysis (10X Genomics) of a uniquely established human tongue cancer organoids, including both chemo-sensitive organoids and chemotherapy resistant organoids.

  Study JGAS000606

• BipEx_Owen_Cardiff

  "BipEx_EGAS000010058455_Owen_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,106 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000139

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• BipEx_Adolfsson_Umea

  "BipEx_EGAS00001005842_Umea University Bipolar Disorder Exomes. This research project was a collaboration between Umea University, Sweden and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 924 Bipolar case/control samples from collaborators in Sweden. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000133

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• Whole genome sequencing of ATCWGS42

  WGS of patient ATCWGS42, a patient who responded to BRAF/MEK targeted therapy but relapsed. This folder includes multi-region sequencing from the patient.

  Study EGAS50000001489

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• PFA ependymoma cancer study

  Sequencing data related the PFA ependymoma study (Michealraj et al., Cell 2020), a lethal glial malignancy of the hindbrain found in babies and toddlers.

  Study EGAS00001004312

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Single-nucleus RNA-sequencing of normal adrenal cortex and adrenocortical tumors

  This study reports a single-nucleus transcriptome atlas of steroid, stromal and immune cells in 38 human normal adrenals and adrenocortical tumors.

  Study EGAS50000000585

• non-malignant plasma cfRNA

  Dataset contains mRNA capture sequencing data from plasma of 125 different human donors: 88 patients with a non-malignant disease and 37 cancer-free controls. Samples were sequenced on a NovaSeq X and sequencing data is provided in FASTQ format.

  Dataset EGAD50000001806

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Genetics of Microcephalic Osteodysplatics Primordial Dwarfism

  This project aims to find causal variants in 50 patients diagnosed with Microcephalic Osteodysplastic Primordial Dwarfism (MOPD), of presumed recessive inheritance performing whole exome sequencing to ~50x mean depth.This is a collaboration with Prof A. Jackson, MRC Human Genetics Unit, Edinburgh

  Dataset EGAD00001000342

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• Melanoma C32 ENU resistance to Combination Therapy

  This study involves mutagenizing C32, a melanoma cell line, with ENU to identify those mutations which engender resistance to a targeted treatment.

  Dataset EGAD00001002234