21248 results for "Buy fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins The process was smooth and quick..ivNx"

in 26.42 milliseconds.

• Stage-specific gene and transcript dynamics in human male germ cells

  To study global transcriptional dynamics during human spermatogenesis we sequenced total RNA of human testicular biopsies with 5 specific histological phenotypes: Sertoli cell-only (SCO, n=3), spermatogenic arrests at the spermatogonial (SPG, n=4), spermatocyte (SPC, n=3), and spermatid (SPD, n=3) level, as well as normal spermatogenesis (Normal, n=3).

  Dataset EGAD00001008652

• The effects of bioinformatics preprocessing on cell-free DNA analysis

  The dataset contain 20 lung cancer and 20 healthy control cfDNA samples from plasma sequenced using 150bp PE sequencing.

  Dataset EGAD50000000213

• Childhood cerebellar tumors mirror conserved fetal transcriptional programs

  We used single-cell transcriptomics to study >60,000 cells from the developing murine cerebellum, and show that different molecular subgroups of childhood cerebellar tumors mirror the transcription of cells from distinct, temporally restricted cerebellar lineages.

  Dataset EGAD00001004318

• A compendium of mutational signatures due to environmental exposures

  Analysis of mutational signatures caused by exposure to known mutagens in human induced pluripotent stem (iPS) cells. A reference human iPS cell-line will be exposed to 100 chemicals known or proposed to be mutagenic. Following exposure to mutagen, cells will undergo a period of recovery before sub clones are generated and sequenced. The progenitor "parental" IPS cell-line will be used to generate reference sequence data, in order to determine the mutational signatures acquired as a result of exposure to different mutagens.

  Dataset EGAD00001005351

• Chromosome Segregation Errors Promote a Diverse Spectrum of Simple and Complex Genomic Rearrangements

  Cancer genomes are frequently characterized by numerical and structural karyotypic abnormalities. Here we combined an inducible centromere-specific inactivation approach with selection for a conditionally essential gene, a strategy we term ‘CEN-SELECT’, and show that single-chromosome missegregation during cell division can directly drive a broad spectrum of structural rearrangement types. Cytogenetic profiling revealed that missegregated chromosomes are 120-fold more susceptible to developing seven major categories of structural variants, including translocations, insertions, deletions, and reassembly into chromothriptically rearranged chromosomes. Whole-genome sequencing of clones with genetically propagatable derivative chromosomes identified complex rearrangements and copy-number alterations that can result in gene inactivation or extrachromosomal gene amplification. We conclude that chromosome segregation errors are sufficient to drive extensive structural variation that recapitulates those commonly associated with human cancers.

  Dataset EGAD00001004163

• The Dutch Microbiome Project Batch 1

  The Dutch Microbiome Project (DMP) data includes shotgun metagenomic sequencing of faecal samples 8,208 Dutch individuals. Paired-end sequencing was performed using Illumina HiSeq 2000 platform. Data is archived in two batches to facilitate easier data access and upload to EGA. Batch 1 of DMP includes 4396 samples.

  Dataset EGAD00001007027

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764