21248 results for "Buy fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins The process was smooth and quick..ivNx"

in 25.21 milliseconds.

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• Whole exome sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region WES from 4 NSCLC patients, totaling 12 tumor samples and 4 matched control samples. The files were submitted as bam files.

  Dataset EGAD00001008382

• Single RNA-Seq of fCAB treated tRNAs from VDH01

  Single RNA-seq of fCAB treated tRNAs from vdh01 samples (5 replicates). tRNAs were extracted using Mirvana° Invitrogen kit. The samples were prepped with Il TruSeq Small RNA and sequenced on Illumina NextSeq550.

  Dataset EGAD00001008743

• Molecular determinants of outcomes in relapsed mantle cell lymphoma treated with ibrutinib or temsirolimus in the MCL3001 (RAY) trial

  234 BAM files containing capture data of MCL tumours and constitutive DNA

  Dataset EGAD00001008975

• Exome sequencing reads of paediatric glioblastoma

  Whole exome sequencing of paediatric glioblastoma with mutations reported in the manuscript: Mutations in ACVR1, FGFR1 and TP53 associate with tumor location in histone H3 K27M pediatric midline high-grade astrocytoma

  Dataset EGAD00001000792

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• TONIC study Whole Exome Sequencing

  Paired-end whole exome sequencing of 50 TNBC breast cancer metastasis samples and matched normal samples obtained from 50 unique patients assayed at study baseline (directly after patient randomization). The included raw sequencing data (fastq-format) were generated using Illumina HiSeq2500 instruments.

  Dataset EGAD00001004857

• DAC for hepatoblastoma sequencing data

  Data Access Committee for sequencing data of hepatoblastoma PDX cell models sequenced under University of Helsinki.

  Dac EGAC50000000548