11935 results for "cancer rna-seq"

in 12.02 milliseconds.

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• Tumor Profiler Ovarian Study

  The Tumor Profiler Study is an observational trial combining a prospective diagnostic approach to assess the relevance of in-depth tumor profiling to support clinical decision-making with an exploratory approach to improve the biological understanding of the disease. Technologies used are digital pathology, targeted NGS, single-cell RNA, single-cell DNA, bulk RNA, bulk proteotyping, single-cell CyTOF, imaging mass cytometry, pharmacoscopy, 4i Drug Response Profiling, and cell-free DNA. These technologies were applied to 240 tumor samples collected over 3 years across three cancer indications: metastatic melanoma, metastatic epithelial ovarian cancer, and acute myeloid leukemia (AML). Here, we publish the scRNA and scDNA data of the ovarian cancer cohort.

  Study EGAS50000000885

• RaScALL: Rapid (Ra) screening (Sc) of RNA-seq data for prognostically significant genomic alterations in acute lymphoblastic leukaemia (ALL)

  RNA-sequencing (RNA-seq) efforts in acute lymphoblastic leukaemia (ALL) have identified numerous prognostically significant genomic alterations which can guide diagnostic risk stratification and treatment choices when detected early. However, a full RNA-seq Bioinformatics workflow is time-consuming and costly in a clinical setting where rapid detection and accurate reporting of clinically relevant alterations are essential. To accelerate the identification of ALL-specific alterations (including gene fusions, single nucleotide variants and focal gene deletions), we developed the rapid screening tool RaScALL, capable of identifying more than 100 prognostically significant lesions directly from raw sequencing reads. RaScALL uses the k-mer based targeted detection tool km and known ALL variant information to achieve a high degree of accuracy for reporting subtype defining genomic alterations compared to standard alignment-based pipelines. Gene fusions, including difficult to detect fusions involving EPOR and DUX4, were accurately identified in 98% (164 samples) of reported cases in a 180-patient Australian study cohort and 95% (n=63) of samples in a North American validation cohort. Pathogenic sequence variants were correctly identified in 75% of tested samples, including all cases involving subtype defining variants PAX5 p.P80R (n=12) and IKZF1 p.N159Y (n=4). Accurate detection of intragenic IKZF1 deletions resulting in aberrant transcript isoforms was also detectable with 98% accuracy. Importantly, the median analysis time for detection of all targeted alterations averaged 22 minutes per sample, significantly shorter than standard alignment-based approaches, ensuring accelerated risk-stratification and therapeutic triage.

  Dataset EGAD00001009087

• GM adipose tissue study

  The Greek Metabolic (GM) adipose study was carried out in 106 individuals living in Greece and consists of genotyping data (chip), RNA-Seq and ATAC-Seq (for a subset of individuals) data from paired biopsies of Subcutaneous and Visceral adipose tissue. eQTL mapping was performed to study gene regulation and findings compared to those from adipose tissue GTEX data. The focus of this project was to study an underexplored population living in different environmental conditions in order to reveal novel regulatory effects for genes that shape complex traits and disease risk. Our results highlight the utility of modest-sized studies in adding to our understanding of the molecular basis of complex traits and to the identification of mechanisms that drive disease in specific tissues.

  Study EGAS00001007126

• Single cell RNA sequencing of colorectal cancer with diverse tissue dissociation protocols or fresh vs. frozen cell preparations.

  To evaluate 3 different tissue dissociation protocols or fresh vs. frozen cell preparations, we performed single-cell RNA sequencing on cancer or distant normal tissue dissociates from 2 colorectal cancer patients. Total 18,409 cells from 10 sample preparations were analyzed (5 primary colorectal cancer and 5 matched normal mucosa). The results suggest highly consistent cellular proportions were recovered with different sample preparation methods.

  Dataset EGAD00001005191

• cfDNA methylation dataset for colon cancer

  Enzymatic conversion-based methylation sequencing data (EM-seq) for colon cancer used in the MESA study

  Dataset EGAD50000000075

• Identification and Characterization of Skin-Resident Memory T cells in Patients with Melanoma-Associated Vitiligo

  Metastatic melanoma patients who develop melanoma-associated vitiligo, an autoimmune cutaneous side effect after receiving immunotherapy, have better overall survival than those who do not develop vitiligo. The objective of this study is to determine the tumor-specific memory T cell responses in the skin, tumor and blood of melanoma patients with vitiligo. Matched melanoma tumor, distant vitiligo-affected skin, and blood were collected and sorted for T cells to perform paralleled single-cell RNA sequencing (scRNA-seq) and single-cell TCR sequencing (scTCR-seq) on the day of tissue collection. The transcriptional analysis identified three resident memory T (TRM) cell subsets which were shared between tumors and vitiligo-affected skin. scRNA-seq identified CD8+ T-cell clonotypes in tumors that co-existed as TRM in skin and as effector memory T (TEM) cells in blood. This study revealed that long-term melanoma survivors maintained memory T cell responses as broadly-distributed TRM and TEM compartments. 

  Study phs002309

• Indonesian RNA-seq data

  Transcription data were collected to study patterns of functional variation across the broad geography of Indonesia. The region has extremely diverse populations, with very different demographic histories and multiple genetic ancestries. This dataset reports high-throughput RNA-sequencing data for individuals from three islands spanning this geographical region: Mentawai, Sumba and West Papua.

  Study EGAS00001003671

• CITE-seq of early breast cancer

  CITE-seq of early breast cancer samples.

  Dataset EGAD00001007058