14989 results for "cancer studies using rna-seq"

in 14.34 milliseconds.

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the feature of age-associated helper T (ThA) cells and its contribution to autoimmune diseases, various peripheral blood immune cell subsets from 136 systemic lupus erythematosus (SLE) and 89 healthy controls (HC) were collected (Naive_CD4, Th1, Th2, Th17, Tfh, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, ThA, Naive_CD8, Naive_B, SM_B, USM_B, DN_B, Plasmablast, NK, CD16p_Mono, CL_Mono, Neu, mDC, pDC, TEMRA_CD8, CM_CD8, EM_CD8, NC_Mono, Int_Mono, LDG). RNA-seq was performed with each cell subset samples.

  Study JGAS000627

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the regulation of gene expression in immune cell subsets and its contribution to autoimmune diseases, 24 peripheral blood immune cell subsets from 50 Systemic Sclerosis and 48 Healthy Controls were collected (Naive_CD4, Mem_CD4, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, Th1, Th2, Th17, Tfh, NK, Naive_CD8, EM_CD8, CM_CD8, TEMRA_CD8, Naive_B, USM_B, SM_B, DN_B, Plasmablast, CL_Mono, Int_Mono, NC_Mono, mDC, pDC). RNA-seq was performed with each immune cell subset samples. After gene expression quantification samples were filtered.

  Study JGAS000296

• Comprehensive molecular profiling of pulmonary pleomorphic carcinoma

  Information regarding the molecular features of pulmonary pleomorphic carcinoma (PPC) is insufficient. Here, we performed next-generation sequencing to determine the genomic and transcriptomic profiles of PPC. Whole exome sequencing (WES) of fresh-frozen tissue samples and target-capture sequencing of formalin-fixed-paraffin-embedded (FFPE) samples were performed. Fresh-frozen tissue samples and FFPE samples were subjected to WES and target-capture sequencing as normal control, respectively. Fresh-frozen tissue samples and 56 FFPE samples were subjected to RNA-seq.

  Study JGAS000297

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  Various peripheral blood immune cell subsets from 89 healthy volunteers and 136 systemic lupus erhythematosus (SLE) donors were collected (Naive_CD4, Mem_CD4, Th1, Th2, Th17, Tfh, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, Naive_CD8, EM_CD8, CM_CD8, TEMRA_CD8, NK, Naive_B, USM_B, SM_B, DN_B, Plasmablast, CL_Mono (or CD16n_Mono), CD16p_Mono, Int_Mono, NC_Mono, mDC, pDC, Neu, LDG). 22 SLE donors were analyzed longitudinally. RNA-seq was performed with each immune cell subset samples. After gene expression quantification samples were filtered.

  Study JGAS000486

• PEACE melanoma 14

  Understanding the evolutionary pathways to metastasis and resistance to immune checkpoint inhibitors (ICI) in melanoma is critical for improving outcomes. Here we present the most comprehensive intra-patient metastatic melanoma dataset assembled to date as part of the PEACE research autopsy programme, including exome, panel-sequenced, RNA-seq, and single-cell whole-genome sequencing samples from 14 ICI-treated patients. The main goals of the project are to decipher the evolutionary dynamics of melanoma metastases and to elucidate mechnisms of resistance to therapies.

  Study EGAS00001007081

• Paired exome analysis in urothelial carcinoma

  In this study we characterized genomic alterations in two to five metachronous tumors from 29 patients initially diagnosed with early stage disease. Fourteen patients (32 tumors) had non progressive disease (NPD) and 15 patients (34 tumors) had progressive disease (PD). Whole exome sequencing (WES, ~50x mean read depth), Ultra deep targeted sequencing (~6,809x mean read depth) and whole transcriptome RNA-seq was performed for all samples. In addition multiregional WES was performed on 8 adjacent regions from a single tumor.

  Study EGAS00001001686

• LCM-RNAseq on human lung macrophages

  In the reported study, we employed Laser Capture Microdissection (LCM) for the transcriptome profiling of lung macrophages cells populations as a function of location within the healthy tissue. In detail, macrophage mini-bulks (100 cells each) were collected by LCM from 4 healthy human donors in 5 different locations of the airways (a total of 20 biopsies), including parenchyma (L1 – lower left lobe (LLL); L6 – 80% distance from LLL tip), trachea (L2), bronchi (L3 – 1st/2nd generation; L5 – 3rd/4th generation) and processed for RNA-seq.

  Study EGAS00001006168

• BAM files of total RNA-Seq data of POPS control samples (GRCh37)

  Placental biopsies (n = 64 female placentas, n = 67 male placentas) were selected from healthy pregnancies from the POPs cohort. A quality control process was also applied for the RNA-Seq datasets: reads were trimmed with Trim Galore!, which uses cutadapt internally and were mapped to the same version of human genome reference (hg19). TopHat2, a splice-aware mapper built on top of Bowtie2 short-read aligner, was used in the mapping process in which so-called two-pass (or two-scan) alignment protocol was applied to rescue unmapped reads from the initial mapping step. In the second mapping, previously unmapped reads were re-aligned to the exon-intron junctions detected in the first-mapping by TopHat2 and were combined across all 131 placenta samples. The initial and second mapped reads were merged by samtools

  Dataset EGAD00001003462

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Log2 normalized TPM matrix for POPLAR (GO28753)

  This dataset contains log2(TPM + 1) for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008390

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391