10888 results for "fc 26 coins u7buy Visit Buyfc26coins.com Megkaptam az FC 26 érméket a garantált idő előtt. Mindig bonuszként!.HNTf"

in 12.06 milliseconds.

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Dataset EGAD00001000002

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• WTCCC2 Pre-eclampsia Study

  A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.

  Study EGAS00001003349

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264