10967 results for "fc 26 coins u7buy Visit Buyfc26coins.com Megkaptam az FC 26 érméket a garantált idő előtt. Mindig bonuszként!.HNTf"

in 15.16 milliseconds.

• A catalog of the genetic causes of Hereditary Angioedema in the Canary Islands (Spain)

  Hereditary angioedema (HAE) is a rare disease where known causes involve C1 inhibitor dysfunction or dysregulation of the kinin cascade. The updated HAE management guidelines recommend performing genetic tests to reach a precise diagnosis. Unfortunately, genetic tests are still uncommon in the diagnosis routine. Here, we characterized for the first time the genetic causes of HAE in affected families from the Canary Islands (Spain). Whole-exome sequencing data was obtained from 41 affected patients and unaffected relatives from 29 unrelated families identified in the archipelago. The Hereditary Angioedema Database Annotation (HADA) tool was used for pathogenicity classification and causal variant prioritization among the genes known to cause HAE. Manual reclassification of prioritized variants was used in those families lacking known causal variants. We detected a total of eight different variants causing HAE in this patient series, affecting essentially SERPING1 and F12 genes, one of them being a novel SERPING1 variant (c.686-12A>G) with a predicted splicing effect which was reclassified as likely pathogenic in one family. Altogether, the diagnostic yield by assessing previously reported causal genes and considering variant reclassifications according to the American College of Medical Genetics guidelines reached 66.7% (95% Confidence Interval [CI]: 30.1-91.0) in families with more than one affected member and 10.0% (95% CI: 1.8-33.1) among cases without family information for the disease. Despite the genetic causes of many patients remain to be identified, our results reinforce the need of genetic tests as first-tier diagnostic tool in this disease, as recommended by the international WAO/EAACI guidelines for the management of HAE.

  Study EGAS00001006547

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• WTCCC2 Pre-eclampsia Study

  A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.

  Study EGAS00001003349