17188 results for "free coins in fc 26 Visit Buyfc26coins.com for latest FC 26 coins news..xwWa"

in 21.54 milliseconds.

• EGAD00010000630

  The TEENAGE study target population comprised adolescent students aged 13 to 15 years attending the first three classes of public secondary schools located in the wider Athens area of Attica.

  Dataset EGAD00010000630

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• GCAT| WGS Structural Variants Catalog V1

  This resource contains the SV annotations using the AnnotSV tool. The description of annotations can be found in AnnotSV web page https://lbgi.fr/AnnotSV/ or GCAT-BSC web page: http://cg.bsc.es/GCAT_BSC_iberianpanel

  Dataset EGAD00010002152

• Pre-neoplastic liver colonization by 11p15.5 altered mosaic cells in young children with hepatoblastoma

  Dataset EGAD00001009669

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• PacBio data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 16 samples sequenced in pools on SMRT Cells 25M on a PacBio Revio instrument. One unaligned BAM file per sample is provided.

  Dataset EGAD50000000798

• RNA-seq (raw fastq files)

  RNA-seq data from lumbar spinal cord blocks from 10 ALS samples and Controls. Raw fastq files are provided in this dataset.

  Dataset EGAD50000000833

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Spatially resolved targetted sequencing of colorectal cancers

  Sequencing of laser-capture micro dissected colorectal tumour glands using a targeted capture panel. Tumours were previously subjected to WGS in the parent EPICC study. UMI-resolved aligned bam files, aligned to hg38.

  Dataset EGAD50000001650

• A distinct monocyte cellular state links systemic immune dysregulation to pulmonary impairment in long COVID

  single cell multiome dataset (snRNA-seq + snATAC-seq) from PBMC of patients with long COVID disease.

  Dataset EGAD50000001729