17139 results for "free coins in fc 26 Visit Buyfc26coins.com for latest FC 26 coins news..xwWa"

in 22.45 milliseconds.

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• Transcriptome-wide gene expression analysis of cocaine use disorder in postmortem human brain tissue

  Dataset contains raw fastq-files from RNA-sequencing analysis of total RNA extracted from Brodmann Area 9 human postmortem brain tissue samples.

  Dataset EGAD50000000212

• DAC Calprotectin in vitro effects on human early hematopoiesis

  Principal Investigator Eric Solary (eric.solary@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Bioinformatics Valentine Marchand (Valentine.MARCHAND@gustaveroussy.fr) Lucie Laplane (lucie.laplane@gustaveroussy.fr) Marine Aglave (Marine.AGLAVE@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000310

• DAC CXCL8 secreted by immature granulocytes inhibits wildtype hematopoiesis in chronic myelomonocytic leukemia

  Principal Investigator Dorothee Selimoglu-Buet (Dorothee.SELIMOGLUBUET@gustaveroussy.fr) Eric Solary (eric.solary@gustaveroussy.fr) Francoise Porteu (francoise.porteu@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000322

• Reconstitution of Human Brain Cell Diversity in Organoids via Four Protocols

  This dataset contains single-cell RNA sequencing and time-course bulk RNA sequencing data of brain organoids grown from multiple cell lines using four different protocols recapitulating dorsal and ventral forebrain, midbrain, and striatum.

  Dataset EGAD50000000938

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-seq

  RNA sequencing files that were used in our study. The cohort was composed of 39 cases of RNA sequencing data. RNA-seq library was prepared with rRNA depletion method, and the sequence was performed using DNBSEQ sequencer.

  Dataset EGAD50000000971

• Whole-genome-sequencing and Whole-exome-sequencing in Spastic paraplegia

  To identify the genetic cause and modifiers of Spastic paraplegia, we performed Whole-genome-sequencing and Whole-exome-sequencing of Spastic paraplegia patients.

  Study JGAS000494