17299 results for "the best way to get coins in fc 26 Navštivte Buyfc26coins.com Společnost známá transparentními transakcemi..CQ2q"

in 20.58 milliseconds.

• Single cell transcriptomes of of primary tumors and normal endometrial derived organoids treated with DBZ

  Endometrial carcinoma, the most common gynecologic cancer, develops from endometrial epithelium which is composed of secretory and ciliated cells. Pathologic classification is unreliable and there is a need for prognostic tools. We used single cell sequencing to study organoid model systems derived from normal endometrial endometrium to discover novel markers specific for endometrial ciliated or secretory cells. We performed single cell sequencing on endometrial and ovarian tumours, and on organoids both treated with DBZ and normal and found both secretory-like and ciliated-like tumour cells.

  Dataset EGAD00001006280

• Whole exome sequencing data of tumor/normal pairs for the study "TGF-β attenuates tumour response to PD-L1 blockade by contributing to exclusion of T cells"

  Tumor DNA was extracted from formalin-fixed and paraffin embedded tumors of a large cohort of bladder cancer patients before treatment with anti-PD-L1. Normal DNA was extracted from matched PBMCs. Whole exome sequencing was performed. This is a subset of patients for which RNA sequencing is also provided (with more detailed phenotypic information).

  Dataset EGAD00001004218

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• single-nuclei RNA-seq of primary pineal parenchymal tumors

  Raw fastq files for 10x Chromium snRNA-seq of pineal parenchymal tumors profiled in the study "A tumor-associated photoreceptor signature unifies distinct central nervous system malignancies".

  Dataset EGAD50000002101

• Nanopore Telomere Sequencing of II.3, II.4, and III.4

  This datasets contains the putative telomeric sequences isolated by TARPON in ubam format after using a Duplex Capture Based Enrichment Protocol for patients II.2, II.4, and III.4.

  Dataset EGAD50000002363

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• Exploring the extracellular transcriptome in seminal plasma for non-invasive prostate cancer diagnosis

  mRNA capture sequencing data of 57 seminal plasma samples.

  Dataset EGAD00001007688

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Epilepsy related sudden death (2019-08-21)

  These samples include exome sequences of samples from patients who suffered Sudden Unexplained Death in Epilepsy. They all are of European descent. . This dataset contains all the data available for this study on 2019-08-21.

  Dataset EGAD00001005276

• CASCADE tumour transcriptome data

  RNA-Seq data from 20 fresh-frozen postmortem samples from three patients who participated in the CASCADE rapid autopsy program and died of metastatic castration resistant prostate cancer.

  Dataset EGAD00001009492

• Target capture sequence for Primary-recurrent HCC study

  This dataset contains target capture sequence data from 255 samples, including 154 tumors and 101 normal samples. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005450

• Clonal Decomposition and DNA Replication States Defined by Scaled Single-Cell Genome Sequencing

  Accurate measurement of clonal genotypes, mutational processes, and replication states from individual tumor-cell genomes will facilitate improved understanding of tumor evolution. We have developed DLP+, a scalable single-cell whole-genome sequencing platform implemented using commodity instruments, image-based object recognition, and open source computational methods. Using DLP+, we have generated a resource of 51,926 single-cell genomes and matched cell images from diverse cell types including cell lines, xenografts, and diagnostic samples with limited material. From this resource we have defined variation in mitotic mis-segregation rates across tissue types and genotypes. Analysis of matched genomic and image measurements revealed correlations between cellular morphology and genome ploidy states. Aggregation of cells sharing copy number profiles allowed for calculation of single-nucleotide resolution clonal genotypes and inference of clonal phylogenies and avoided the limitations of bulk deconvolution. Finally, joint analysis over the above features defined clone-specific chromosomal aneuploidy in polyclonal populations.

  Study EGAS00001003190

• RNASeq Whole Transcriptome Expression Profiles of NFE2 and PF4 as Translational Biomarkers for BET Inhibition-Induced Thrombocytopenia in Preclinical and Clinical Studies

  Longitudinal blood samples for exploratory biomarker analysis were collected from 51 out of 83 patients enrolled in CA011-001 (NCT02419417) study of BMS-986152, totaling 425 samples collected on three different dosing schedules (A, B, and C). Whole transcriptome expression profiling was performed on the collected blood samples using RNASeq, with Illumina TruSeq library preparation and paired sequencing. Gene expression data was quantified as transcripts per million (TPM).

  Dataset EGAD50000001659

• Genomic and Transcriptomic Profile of Paired Primary-Metastasis Colorectal Tumors

  Samples encompass primary colorectal tumors, adjacent normal colonic mucosa and metastasis of 12 patients, collected by Medical Pathologists from surgically removed specimens. Normal mucosa samples were taken more than 2 cm away from the tumor. Tissues were embedded in optimal cutting temperature (OCT) medium, snapshot frozen in liquid nitrogen within 40 minutes of collection and preserved at -80ºC. Samples were collected between June 2010 and October 2017 as part of a prospective biobanking project.

  Dataset EGAD00001007686

• Oral microbiota composition assessed with 16S rRNA sequencing from adults aged over 65 years old.

  This is a oral microbiota amplicon dataset derived from adult participants aged over 65 years old. It consists a total number of 491 samples, stored in 982 paired-end FASTQ files with sequence lengths of 200 nucleotides generated with a Illumina MiSeq. Of those 491 samples, 347 were used in analysis, the remaining 144 samples are control samples.

  Dataset EGAD00001007705

• Single-cell RNA-seq data of bronchoalveolar lavage fluid and extramedullary relapse of a multiple myeloma patient with sarcoidosis-like reactions after anti-BCMA CAR T-cell therapy

  We performed single-cell RNA-sequencing (scRNA-seq) of cells in the bronchoalveolar lavage (BAL) fluid at 3-month follow-up of a multiple myeloma patient experiencing sarcoidosis-like pulmonary reactions after anti-BCMA CAR T-cell therapy (Sample alias: A8_3, A9_3; technical replicates). In addition we performed scRNA-seq of a extramedullary relapse lesion at 6-month follow-up (Sample alias: B10_3).

  Dataset EGAD00001008649

• Evolutionary Genome Analysis of Transformation into Small Cell Carcinomas from Lung Adenocarcinomas

  This dataset includes the high-throughput sequencing data from a study entitled "Clonal History and Genetic Predictors of Transformation into Small Cell Carcinomas from Lung Adenocarcinomas". Whole-genome sequencing libraries were generated by PCR-free methods, and sequencing run was made in HiSeq X or HiSeq 2500 machines. PCR duplicates-marked, indel-realigned, and base-recalibrarted BAM files are provided in our dataset.

  Dataset EGAD00001003315

• FFPE, buffycoat and cell free DNA from N. German esophagus cancer patients - 2021

  28 patients. Cell-free DNA and leukocyte DNA, both from before any neoadjuvant treatment. Tumor FFPE tissue (plus metastasic tissue for some patients) from after any neoadjuvant treatment. Some cfDNA from follow-up time points (e.g. after neodj. treatment or in the clinical course). IDT xgen Pan-Cancer panel for hybridisation capture. Illumina TruSeq library prep for cfDNA and leukocyte DNA, Illumina DNA Prep for FFPE DNA. n=150 libraries in total.

  Dataset EGAD00001010081

• HIPO016 - glioblastoma tumour methylation microarray profiling

  Methylation microarray profiling (Illumina Human Methylation 450k and EPIC platforms) of 60 adult glioblastomas. Tumours were subtyped using the approach from Sturm et al. (https://doi.org/10.1016/j.ccr.2012.08.024): 12 IDH, 18 MES, 12 RTK I, 18 RTK II. DNA was prepared, assayed on the microarrays, and raw data computationally processed as described in Capper et al., "DNA methylation-based classification of central nervous system tumours": https://www.nature.com/articles/nature26000

  Dataset EGAD00010001797

• SNP array

  The whole study comprises of two patient cohorts. Screening cohort: 40 patients of Germany; validation cohort: 40 patients from Asia. Further, bile duct and CCA cell lines have been analyzed.
This dataset contains SNP array data for tumor/normal pairs for a subset of 36 patients from the screening cohort plus an additional relapse tumor of one of those 36 patients. Data was generated on a OmniExpress-24 v1.1 Bead Array (Illumina) and is stored in IDAT file format.

  Dataset EGAD00010002597

• TIRE-seq_PDN

  TIRE-seq is a novel RNA sequencing method that integrates mRNA purification directly into library preparation, eliminating separate RNA extraction. The technique demonstrated utility across three biological applications, including capturing transcriptional changes in human T cells, identifying genes driving murine dendritic cell differentiation, and analyzing the dose-response effects of temozolomide on patient-derived neurospheres. With its simplified approach and high sequencing efficiency, TIRE-seq offers a cost-effective solution for large-scale gene expression studies.

  Dataset EGAD50000001261