12513 results for ""non-traditional+communal+storytelling+approach"+novel+segment+noted+in+critical+commentary"

in 25.30 milliseconds.

• GCAT| WGS Structural Variants Catalog V1

  This resource contains the SV annotations using the AnnotSV tool. The description of annotations can be found in AnnotSV web page https://lbgi.fr/AnnotSV/ or GCAT-BSC web page: http://cg.bsc.es/GCAT_BSC_iberianpanel

  Dataset EGAD00010002152

• Pre-neoplastic liver colonization by 11p15.5 altered mosaic cells in young children with hepatoblastoma

  Dataset EGAD00001009669

• Roifman_DAC

  This Data Access Committee (DAC) will be set up to review applications, and render decisions for requests submitted to EGA to access data deposited into ega-box-1592 by Dr. Chaim Roifman at the Hospital for Sick Children in Toronto, Canada. Contact: Dr. Chaim Roifman. email:chaim.roifman@sickkids.ca

  Dac EGAC50000000243

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• PacBio data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 16 samples sequenced in pools on SMRT Cells 25M on a PacBio Revio instrument. One unaligned BAM file per sample is provided.

  Dataset EGAD50000000798

• RNA-seq (raw fastq files)

  RNA-seq data from lumbar spinal cord blocks from 10 ALS samples and Controls. Raw fastq files are provided in this dataset.

  Dataset EGAD50000000833

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• DNAmet

  DNAmet analysis of olfactory mucosa (OM) cells derived from cognitively healthy and individuals with AD exposed to traffic-related ultrafine particles (UFPs) for 72h in submerged cultures. The UFPs used for exposures were: A0 and A20. Exposures were compared to the corresponding blank samples.

  Dataset EGAD50000001531

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562