4822 results for "*oma"

in 30.43 milliseconds.

• Single-cell Analysis of Neoplastic Plasma Cells Identifies Novel Myeloma Pathobiology Mediators and Potential Targets

  Newly diagnosed symptomatic and relapsed/refractory myeloma is a clonal plasma cell (PC) dyscrasia that arises from precursors which have been studied utilizing bulk or single-cell (sc) techniques. By combining scRNA-sequencing with scB-cell receptor (BCR)-sequencing, we found more dysregulated genes in monoclonal PCs compared with analyses of the entire CD138+ population, which includes non-neoplastic/polyclonal PCs. Paired tumor and non-tumor WGS was performed to evaluate the presence of IgH-associated translocations and hyperdiploidy events, initially detected by FISH, in a subset of samples included in this study.

  Study EGAS50000000801

• Single-cell Analysis of Neoplastic Plasma Cells Identifies Myeloma Pathobiology Mediators and Potential Targets

  Multiple myeloma is a clonal plasma cell (PC) dyscrasia that arises from precursors and has been studied utilizing approaches focused on CD138+ cells. By combining single-cell (sc)RNA- with scB-cell receptor (BCR)-sequencing, we differentiate monoclonal/neoplastic from polyclonal/normal PCs, and find more dysregulated genes, especially in precursor patients, than by analyzing bulk PCs. To determine if this approach can identify oncogenes that contribute to disease pathobiology, MAD2L1 and MAT2A are validated as targets with drug-like molecules that suppress myeloma growth in pre-clinical models. Moreover, functional studies show a role of LAMP5, which is uniquely expressed in neoplastic PCs, in tumor progression and aggressiveness via interactions with c-MYC. Finally, a monoclonal antibody recognizing cell-surface LAMP5 shows efficacy as an antibody-drug conjugate and in a chimeric antigen receptor-guided T-cell format. These studies provide additional insights into myeloma biology and identify potential targeted therapeutic approaches that can be applied to reverse myeloma progression.

  Study EGAS50000000802

• Single-cell Analysis of Neoplastic Plasma Cells Identifies Novel Myeloma Pathobiology Mediators and Potential Targets

  Newly diagnosed symptomatic and relapsed/refractory myeloma is a clonal plasma cell (PC) dyscrasia that arises from precursors which have been studied utilizing bulk or single-cell (sc) techniques. By combining scRNA-sequencing with scB-cell receptor (BCR)-sequencing, we found more dysregulated genes in monoclonal PCs compared with analyses of the entire CD138+ population, which includes non-neoplastic/polyclonal PCs. We identified a panel of genes that were over- or under-expressed in symptomatic states that could be putative oncogenic drivers or tumor suppressors, respectively.

  Study EGAS50000000803

• WGS of Newly Diagnosed and Refractory/Relapsed Multiple Myeloma

  This dataset includes paired tumor and non-tumor WGS data from patients diagnosed with newly diagnosed (n = 6), refractory/relapsed multiple myeloma (n = 3) or plasma cell leukemia (n = 1). These samples presented >95% tumor PCs in bone marrow aspirates. Plasma cells and T cells (non-tumor cells) were isolated from bone marrow aspirates using a magnetic approach.

  Dataset EGAD50000001177

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Single-cell Transcriptome Analysis of Plasma Cells Across the Disease Spectrum of Multiple Myeloma

  This dataset includes FastQ files of single-cell RNA sequencing data of 5' GEX and VDJ libraries from CD138+ plasma cells enriched from 72 bone marrow aspirates from patients diagnosed with a monoclonal gammopathy from the multiple myeloma spectrum, including MGUS (n=13), SMM (n = 22), NDMM (n = 17), RRMM (n = 15) and PCL (n = 2); and 3 controls.

  Dataset EGAD50000001179

• MDACC Lymphoma & Myeloma WGS of Tumor and Non-tumor Cells in Multiple Myeloma

  FastQ files from paired tumor and non-tumor WGS data from patients diagnosed with newly diagnosed (n = 6), refractory/relapsed multiple myeloma (n = 3) or plasma cell leukemia (n = 1). These samples presented >95% tumor PCs in bone marrow aspirates. Plasma cells and T cells (non-tumor cells) were isolated from bone marrow aspirates using a magnetic approach.

  Dac EGAC50000000282

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• MDACC Lymphoma & Myeloma scRNAseq of Plasma Cells in Multiple Myeloma

  FastQ files from Chromium single cell 5' gene expression and B-cell receptor sequencing of plasma cells from patients diagnosed with a monoclonal gammopathy of the multiple myeloma spectrum, including the precursor stages MGUS (n =13) and SMM (n = 22); newly diagnosed (n = 17); relapsed (n = 15); and plasma cell leukemia (n = 2); and 3 controls.

  Dac EGAC50000000271

• TRACERx NSCLC - whole genome sequencing for ctDNA study

  An ultra-sensitive and specific ctDNA assay provides novel pre-operative disease stratification in early stage lung adenocarcinoma

  Study EGAS50000000313