4772 results for "*oma"

in 28.75 milliseconds.

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• MDACC Lymphoma & Myeloma scRNAseq of Plasma Cells in Multiple Myeloma

  FastQ files from Chromium single cell 5' gene expression and B-cell receptor sequencing of plasma cells from patients diagnosed with a monoclonal gammopathy of the multiple myeloma spectrum, including the precursor stages MGUS (n =13) and SMM (n = 22); newly diagnosed (n = 17); relapsed (n = 15); and plasma cell leukemia (n = 2); and 3 controls.

  Dac EGAC50000000271

• TRACERx NSCLC - whole genome sequencing for ctDNA study

  An ultra-sensitive and specific ctDNA assay provides novel pre-operative disease stratification in early stage lung adenocarcinoma

  Study EGAS50000000313

• Peripheral T cell lymphoma (PTCL) Shallow Whole Genome Sequencing

  Shallow Whole Genome Sequencing (sWGS) of 148 FFPE DNA samples from peripheral T cell lymphoma (PTCL) samples. Assoicated with the "Molecular biomarkers for stratification peripheral T cell lymphoma" study.

  Dataset EGAD50000001146

• metastatic uveal melanoma tumour biopsies

  Tumour biopsies were obtained from uveal melanoma patients pre and 16 days post treatment with tebentafusp. Biopsies, which were either snap frozen or put in RNA later, were analysed by bulk RNA sequencing (50 million reads per sample) using the Illumina NovaSeq system.

  Study EGAS50000000864

• mUM patient biopsies pre and post treatment with tebentafusp

  The dataset includes 141 RNA-seq samples form mUM patietns. Tumour biopsies were obtained from uveal melanoma patients pre and post treatment with tebentafusp. Biopsies, which were either snap frozen or put in RNA later, were analysed by bulk RNA sequencing (50 million reads per sample) using the Illumina NovaSeq system.

  Dataset EGAD50000001258

• International Cancer Proteogenome Consortium (ICPC): Proteogenomics of Oral Squamous Cell Carcinoma in Taiwan

  Oral cavity squamous cell carcinoma (OSCC) is the major subtype (~90%) of oral cancer, which is leading cancer with high mortality worldwide. The environmental risk factors associated with OSCC are quite different in Taiwan as compared to other populations. In most non-Taiwanese populations, OSCC is often associated with tobacco chewing, cigarette smoking, alcohol drinking, or human papillomavirus (HPV) infection. In Taiwan, in contrast, the OSCC occurs mainly in males aged 30 years or older who have habitual betel nut chewing, cigarette smoking, and alcohol drinking. To uncover molecular mechanisms and identify new therapeutic strategies of oral squamous cell carcinoma, this study recruited 112 treatment-naïve OSCC patients and generated multi-omics data, including WES, RNA-Seq, TMT-labeled proteomes, and phosphoproteomes from paired normal/tumor tissues. We have investigated our multi-omics data, covering molecular characterizations such as mutation signatures, impacts of mutations on RNA/protein/phosphoprotein, RNA-protein correlation, somatic copy number alteration, and the relationship with RNA & protein, proteome, and phosphoproteome analysis (T vs NAT), novel peptides (somatic variants, neoantigens, CT antigens, T cell receptors, etc.), as well as molecular subtyping (& pathway analysis). Notably, we have discovered a higher frequency of APOBEC3B deletion polymorphism in the Taiwanese population, and APOBEC3A is a potential prognostic biomarker. Our proteogenomic data enable us to further stratify patients into four groups based on APOBE3A expression level, which is found inversely correlated with EGFR expression. Therefore, the patients with high EGFR and low APOBEC3A expression may benefit from anti-EGFR therapy, while those with low EGFR and high APOBEC3A expression may benefit from immunotherapy. To clarify if there is an interaction between genetic polymorphisms and betel nut chewing habit in Taiwanese OSCC, we plan to concurrently evaluate the effect of habitual betel nut chewing on the gene mutation pattern, the dysregulated protein/phosphoproteins as novel biomarkers and/or therapeutic targets, and the molecular subtyping of patients for effective treatments. 

  Study phs002580

• A neoadjuvant, phase II trial demonstrates efficacy and tolerability of Talimogene laherparepvec in cutaneous basal cell carcinoma (NeoBCC trial)

  We present a single arm, phase II neoadjuvant trial with the oncolytic virus Talimogene laherparepvec (T-VEC) in 18 patients with difficult-to-resect basal cell carcinomas. Six cycles of T-VEC were applied intralesionally. The primary endpoint of the study, defined as the proportion of the patients, who after six cycles of T-VEC (13 weeks) at the time point of surgery, become resectable with primary wound closure without the need for plastic reconstructive surgery like skin flaps or skin grafts, was achieved (9/18 patients; 50.0%). Secondary endpoints also included the relapse free survival rate (100%), overall survival (100%) and biological read outs in the tumor samples. T-VEC led to a significant increase of cytotoxic T cells, B cells and myeloid cells, and a decrease of Tregs within the tumor microenvironment. We observed a potent induction of antitumoral and antiviral T cell clones, as well as a strong humoral immune response. The objective response rate was 55.6% and the complete pathological response rate was 33.3%. Only mild adverse events occurred. Together, neoadjuvant T-VEC represents a viable treatment option for patients with difficult-to-resect BCCs (EudraCT Number 2018-002165-19).

  Study EGAS50000000252

• Epigenetic landscape reorganization and reactivation of embryonic development genes are associated with malignancy in IDH-mutant astrocytoma

  Accurate grading of IDH-mutant gliomas is crucial for determining patient prognosis and guiding treatment decisions. However, histological grading can be challenging, so we aimed to identify objective molecular markers. To this end, we conducted bulk RNA sequencing on primary IDH-mutant astrocytomas (n=138) from the prospective CATNON trial, which evaluated the prognostic impact of adjuvant and concurrent temozolomide. Using this data, we sought to identify molecular markers linked to increased malignancy in IDH-mutant astrocytomas to establish objective grading criteria.

  Study EGAS50000000381

• Whole exome sequencing of pre-invasive lung adenocarcinoma in non-smokers

  The prevalence of lung adenocarcinoma (LUAD) has increased sharply in East Asia. Early diagnosis leads to better survival rates, but this requires an improved understanding of the molecular changes during early tumorigenesis, particularly in non-smokers. We performed whole exome-sequencing and RNA-sequencing for samples from 94 East Asian patients with precancerous lesions (25 with atypical adenomatous hyperplasia [AAH]; 69 with adenocarcinoma in situ [AIS]) and 73 patients with early invasive lesions (minimally invasive adenocarcinoma [MIA]). Cellular analysis revealed that the activities of endothelial and stromal cells could categorize tumors into molecular subtypes within pathology-defined lesion types. These subtypes were linked with the advanced radiology-defined lesion type and coordinated with immune cell infiltration throughout the progression of LUAD. Characterization of these lesion types identified positively selected mutation patterns, and suggested that angiogenesis of the late-stage AIS type potentially contributes to tissue invasion of the MIA type. Our findings offer a novel resource that may help to improve early diagnosis and patient prognosis, and also suggest possible approaches for early disease interception.

  Study EGAS50000000438