5525 results for "*oma"

in 32.90 milliseconds.

• Shallow Whole Genome Sequencing (sWGS) of pancreatic ductal adenocarcinoma

  Associated with CNA differences between RNA-based subtypes of PDAC. Shallow Whole Genome Sequencing (sWGS) generated 47 .bam files from 37 patients. sWGS was used for Copy number aberrations (CNA) determination.

  Dataset EGAD50000001732

• WES dataset of a TIL-ACT metastatic melanoma cohort

  Whole-exome sequencing (WES) data from 13 patients with metastatic melanoma in a TIL-ACT cohort, generated to characterize tumor genomics and neoantigen landscapes relevant to adoptive T cell therapy.

  Dataset EGAD50000001731

• Five Mantle Cell Lymphoma Patients Before and After Failure of Standard Chemotherapy

  MCL cells were isolated from different tissues of five patients with MCL at diagnosis, and at the time of the first clinical relapse after failure of standard immunochemotherapy based on alternation of R(ituximab)-CHOP and R-high-dose-araC. All patients signed informed consent according to the Declaration of Helsinki. Four patients were diagnosed with classical nodal aggressive MCL, and all these patients experienced early relapse (i.e., progression of disease POD < 12 months). One patient was diagnosed with indolent non-nodal MCL and relapsed 9 years after initial MCL diagnosis. The dataset presents single cell RNA sequencing data as well as whole exome sequencing data for these five patients.

  Dataset EGAD50000001213

• Exome-sequencing on early oral squamous cell carcinoma with clear margins

  Whole exome sequencing (WES) on early oral squamous cell carcinoma (OSCC) with clear margins, and on resection margins, 86 patients with a median follow-up of 58 months (range 30.4-83 months). Raw data (fastq format).

  Dataset EGAD50000001209

• Single-cell RNA-sequencing on malignant and benign tissue samples

  Single-cell RNA-sequencing on malignant and benign tissue samples from untreated donors with colorectal adenocarcinoma and liver metastasis was performed in order to deduce tissue adaptive expression patterns of the disease. Matching tissue from five donors with untreated CRC and liver metastasis were sampled.

  Dataset EGAD50000001203

• Whole Exome Sequencing of paired gDNAs and PPGL tumor DNA from patients with cyanotic congenital heart disease

  Fastq files from Whole Exome Sequencing of 12 paired germline DNA (from blood/saliva) and 14 PPGL tumor DNA (from formalin-fixed paraffin-embedded (FFPE) blocks from surgery) from patients with cyanotic congenital heart disease (CCHD) and pheochromocytoma and paraganglioma (PPGL). Sequencing was performed using the Illumina HiSeq4000.

  Dataset EGAD50000001201

• Single-Cell and Bulk RNA Sequencing of Oncolytic Measles Virus Treatment in Pediatric Medulloblastoma and ATRT

  This dataset includes single-cell RNA sequencing profiles from five mice bearing Group 3 medulloblastoma (CSCG) treated with oncolytic measles virus (MV-NIS) and three mice treated with MV-NIS combined with anti-PD1 therapy. Additionally, bulk RNA sequencing data were generated from 12 samples across PBS control, heat-inactivated (HI) control, MV mid-treatment, and treatment resistance conditions. Pediatric patient data were collected from the PNOC005 trial, which enrolled patients into three strata: Stratum A (focal recurrence, local MV-NIS administration post-surgical resection), Stratum B (disseminated recurrence, single MV-NIS dose via lumbar puncture), and Stratum C (disseminated recurrence, two consecutive MV-NIS doses via lumbar puncture on Day 0 and Day 7). Whole blood and PBMC samples were collected from 17 patients across all strata, generating 72 bulk RNA-seq datasets at multiple time points. All datasets are provided as raw sequencing data in FASTQ format.

  Dataset EGAD50000001197

• Single-cell Transcriptome Analysis of Plasma Cells Across the Disease Spectrum of Multiple Myeloma

  This dataset includes FastQ files of single-cell RNA sequencing data of 5' GEX and VDJ libraries from CD138+ plasma cells enriched from 72 bone marrow aspirates from patients diagnosed with a monoclonal gammopathy from the multiple myeloma spectrum, including MGUS (n=13), SMM (n = 22), NDMM (n = 17), RRMM (n = 15) and PCL (n = 2); and 3 controls.

  Dataset EGAD50000001179

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• WGS of Newly Diagnosed and Refractory/Relapsed Multiple Myeloma

  This dataset includes paired tumor and non-tumor WGS data from patients diagnosed with newly diagnosed (n = 6), refractory/relapsed multiple myeloma (n = 3) or plasma cell leukemia (n = 1). These samples presented >95% tumor PCs in bone marrow aspirates. Plasma cells and T cells (non-tumor cells) were isolated from bone marrow aspirates using a magnetic approach.

  Dataset EGAD50000001177