5032 results for "*oma"

in 19.42 milliseconds.

• Whole Exome Sequencing of paired gDNAs and PPGL tumor DNA from patients with cyanotic congenital heart disease

  Fastq files from Whole Exome Sequencing of 12 paired germline DNA (from blood/saliva) and 14 PPGL tumor DNA (from formalin-fixed paraffin-embedded (FFPE) blocks from surgery) from patients with cyanotic congenital heart disease (CCHD) and pheochromocytoma and paraganglioma (PPGL). Sequencing was performed using the Illumina HiSeq4000.

  Dataset EGAD50000001201

• Single-Cell and Bulk RNA Sequencing of Oncolytic Measles Virus Treatment in Pediatric Medulloblastoma and ATRT

  This dataset includes single-cell RNA sequencing profiles from five mice bearing Group 3 medulloblastoma (CSCG) treated with oncolytic measles virus (MV-NIS) and three mice treated with MV-NIS combined with anti-PD1 therapy. Additionally, bulk RNA sequencing data were generated from 12 samples across PBS control, heat-inactivated (HI) control, MV mid-treatment, and treatment resistance conditions. Pediatric patient data were collected from the PNOC005 trial, which enrolled patients into three strata: Stratum A (focal recurrence, local MV-NIS administration post-surgical resection), Stratum B (disseminated recurrence, single MV-NIS dose via lumbar puncture), and Stratum C (disseminated recurrence, two consecutive MV-NIS doses via lumbar puncture on Day 0 and Day 7). Whole blood and PBMC samples were collected from 17 patients across all strata, generating 72 bulk RNA-seq datasets at multiple time points. All datasets are provided as raw sequencing data in FASTQ format.

  Dataset EGAD50000001197

• Single-cell Transcriptome Analysis of Plasma Cells Across the Disease Spectrum of Multiple Myeloma

  This dataset includes FastQ files of single-cell RNA sequencing data of 5' GEX and VDJ libraries from CD138+ plasma cells enriched from 72 bone marrow aspirates from patients diagnosed with a monoclonal gammopathy from the multiple myeloma spectrum, including MGUS (n=13), SMM (n = 22), NDMM (n = 17), RRMM (n = 15) and PCL (n = 2); and 3 controls.

  Dataset EGAD50000001179

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• WGS of Newly Diagnosed and Refractory/Relapsed Multiple Myeloma

  This dataset includes paired tumor and non-tumor WGS data from patients diagnosed with newly diagnosed (n = 6), refractory/relapsed multiple myeloma (n = 3) or plasma cell leukemia (n = 1). These samples presented >95% tumor PCs in bone marrow aspirates. Plasma cells and T cells (non-tumor cells) were isolated from bone marrow aspirates using a magnetic approach.

  Dataset EGAD50000001177

• Shallow dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. shallow Whole Genome Sequencing (sWGS) of 63 samples. sWGS was done to analyze copy number aberration.

  Dataset EGAD50000001165

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• Refractory Classic Hodgkins Lymphoma (cHL) sWGS

  Associated with the study: Blood-based Monitoring of Relapsed/Refractory Hodgkin Lymphoma Patients Predict Responses to Anti-PD-1 Treatment. 26 ctDNA Samples from 4 patients followed longitudinally. sWGS performed for copy number aberration (CNA) analysis.

  Dataset EGAD50000001163

• nEODURVARIB clinical trial. Exome sequencing in advanced urothelial carcinoma

  Exome sequencing (BAM and VCF files) in advanced urothelial carcinoma in diagnostic and pos-ttreatment samples

  Dataset EGAD50000001162

• mUM patient biopsies bulk RNAseq

  Tumour biopsies were obtained from uveal melanoma patients (n = 35) pre and 16 days post treatment with tebentafusp. Biopsies, which were either snap frozen or put in RNA later, were analysed by bulk RNA sequencing (50 million reads per sample) using the Illumina NovaSeq system

  Dataset EGAD50000001225

• Bulk RNA-sequencing data of advanced hepatocellular carcinoma (HCC) patients treated with atezolizumab plus bevacizumab.

  The dataset includes FASTq files and normalised gene expression counts from bulk RNA-sequencing of pre-treatment tumour (n=39) and adjacent non-tumour tissue samples (n=13) from advanced hepatocellular carcinoma (HCC) patients treated with atezolizumab plus bevacizumab. Specifically, RNA was extracted from the FFPE tumour tissue using RNeasy Plus Mini Kit (Qiagen), according to the manufacturer’s instructions. RNA quality and quantity were evaluated using Agilent RNA 600 Pico Chips (Agilent Technologies). Sequencing libraries were prepared using the SMARTer Stranded Total RNA-seq kit v3 (Takara Bio). Sequencing was performed on an Illumina NovaSeq 6000 system. After obtaining the Fastq files, read 2 UMIs and adapters were trimmed using seqtk (v1.2), reads were aligned using STAR (v2.7.7a) to the human reference genome (GRCh38) and quantified with HTSeq (v2.0.2).

  Dataset EGAD50000001227

• WES PTCL Data

  Whole Exome Sequencing (WES) of 153 FFPE DNA samples of Peripheral T-Cell Lymphoma. Associated with "Molecular biomarkers for stratification periheral T cell lymphoma" study.

  Dataset EGAD50000001250

• Low-coverage Single-cell Whole Genome Sequencing Data from Paired Meningioma Samples

  This dataset comprises low-coverage (~0.5X) whole genome sequencing data from 179 single cells isolated from paired meningioma samples (88 cells from initial grade II and 91 cells from recurrent grade III tumor from the same patient). The single-cell libraries were constructed using Primary Template Amplification and ResolveDNA protocol, with libraries subsequently sequenced on NextSeq 1000 using 2x150bp paired-end reads targeting 8M reads per cell. This dataset includes the sequencing data in Fastq format.

  Dataset EGAD50000001254

• mUM patient biopsies pre and post treatment with tebentafusp

  The dataset includes 141 RNA-seq samples form mUM patietns. Tumour biopsies were obtained from uveal melanoma patients pre and post treatment with tebentafusp. Biopsies, which were either snap frozen or put in RNA later, were analysed by bulk RNA sequencing (50 million reads per sample) using the Illumina NovaSeq system.

  Dataset EGAD50000001258

• Paired FastQ files from deep targeted DNA sequencing

  This dataset comprises paired-end and time-matched FastQ files from 356 cell-free DNA samples and 356 white blood cell DNA samples, derived from 299 patients with metastatic renal cell carcinoma or urothelial carcinoma. A baseline sample was available for all patients. Sequencing was performed using Illumina technology.

  Dataset EGAD50000001267

• RNA-sequencing from ALL patients treated on the Australasian Leukaemia and Lymphoma Group (ALLG) ALL06 study.

  Dataset contains RNA-sequencing data (fastq files) from 45 patients treated on the the Australasian Leukaemia and Lymphoma Group (ALLG) ALL06 study, an MRD-stratified Paediatric Protocol. Patient samples (bone marrow or peripheral blood) were taken at diagnosis. mRNA was extracted from blast cells and underwent paired-end sequencing (75bp) using the illumina NextSeq platform. Genomic data was used for identification of genomic drivers of acute lymphoblastic leukaemia (ALL).

  Dataset EGAD50000001111

• Dataset for scRNA glioblastoma samples

  This dataset contains 5 scRNA samples of human glioblastoma samples, human cortical spheroid derived from hiPSC line 028-4 and 3 samples of mouse xenografts. Sequencing has been performed on Illumina NovaSeq 6000. Sequencing has always been paired.

  Dataset EGAD50000001117

• Single-cell RNAseq data from 6 Invasive Lobular Carcinoma (ILC)

  Fastq files of single-cell RNAseq data from from Cancer Associated Fibroblasts (CAFs), cancer cells and immune cells isolated from 6 primary Invasive Lobular Carcinomas (ILCs)

  Dataset EGAD50000001121

• High-grade serous ovarian carcinoma tumour whole genome sequencing variants

  Tumour somatic variants (in VCF format) called from paired tumour-germline whole genome sequencing (using IDT library preparation system followed by sequencing on Illumina NovaSeq platform) of three high-grade serous ovarian tumour samples. The dataset comprises three VCF variant files.

  Dataset EGAD50000001131

• High-grade serous ovarian carcinoma tumour exome sequencing variants

  Tumour variants (in VCF format) from exome sequencing (using Agilent SureSelect and TWIST library preparation systems followed by sequencing on Illumina HiSeq and NovaSeq platforms) of 108 high-grade serous ovarian tumour samples. Germline variants from EGAD00001006030 for these individuals were used to call somatic and tumour-only variants separately, creating two VCF files per sample (except for one sample without paired germline data- somatic variant file only provided). The dataset comprises 215 VCF variant files.

  Dataset EGAD50000001132

• Whole Exome Sequencing Data of 34 indolent primary renal B-Cell lymphoma cases

  Here, 34 iNHL samples were sequenced using whole exome sequencing to describe the mutational landscape of indolent primary renal B-Cell lymphomas. Mutational profiles were compared to other Marginal Zone Lymphomas.

  Dataset EGAD50000001136

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• Transcriptome - Uveal Melanomas MPI

  Total RNA sequencing on 4 uveal melanoma samples. Libraries were prepared using the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001138

• scRNA-seq of human follicular lymphoma and lymph node

  Cryopreserved cells from human nodal follicular lymphoma and lymph node samples were thawed and processed for scRNA-seq analysis. CD3+ CD19− 7-AAD− live T cells (six FL samples from the Original cohort) or 7-AAD− whole live hematopoietic cells (five lymph node and nine FL samples from Validation cohort 1) were sorted using a FACS Aria II or III instrument (BD Biosciences). To generate single-cell emulsions, 6,000–10,000 live cells were loaded into the 10X Genomics Chromium Controller for single-cell partitioning, along with the reverse transcriptase reagent mixture and 3' or 5' gel beads. Sorted T or whole hematopoietic cells were converted to barcoded scRNA-seq libraries using 10X Genomics Chromium single cell 3' reagent kits (v3) for the Validation cohort 1, 5' reagent kits (v1) for the Original cohort, according to the manufacturer’s instructions. The libraries were sequenced on an Illumina HiSeq X Ten or NovaSeq X Plus system, mapped to the human genome (build GRCh38), and demultiplexed using CellRanger pipelines (v3.1.0, 10x Genomics).

  Dataset EGAD50000001143

• Peripheral T cell lymphoma (PTCL) Shallow Whole Genome Sequencing

  Shallow Whole Genome Sequencing (sWGS) of 148 FFPE DNA samples from peripheral T cell lymphoma (PTCL) samples. Assoicated with the "Molecular biomarkers for stratification peripheral T cell lymphoma" study.

  Dataset EGAD50000001146