21187 results for "Buy fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins The process was smooth and quick..ivNx"

in 28.10 milliseconds.

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001002844

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001003086

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001003058

• Whole genome and RNA-sequencing in T-cell acute lymphoblastic leukemia

  Dataset includes whole genome and transcriptomic sequencing data from five T-cell acute lymphoblastic leukemia (T-ALL) patients. Whole genome sequencing has performed from both diagnostic (T-ALL sample) and control (remission sample) samples. RNA-sequencing has performed from diagnostic samples. Samples has been taken from the bone marrow or peripheral blood.

  Dataset EGAD00001008658

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001002303

• DAC for Sarcopenia HNSCC

  Data access committee for Sarcopenia HNSCC study

  Dac EGAC50000000420

• ChIP-Seq (H3K4me3, H3K4me1, H3K9me3, H3K27ac, H3K27me3, H3K36me3, Input) data for HL60 cell line generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency.

  ChIP-Seq (H3K4me3, H3K4me1, H3K9me3, H3K27ac, H3K27me3, H3K36me3, Input) data for HL60 cell line generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency.

  Dataset EGAD00001002238

• DAC for study Screening for abnormal CGI methylation in primary colorectal tumours

  Dac EGAC00001000069

• Data Access Committee for German Consortium for Translational Cancer Research (DKTK)

  Dac EGAC00001000217

• Data Access Committee for COLO829 Somatic reference standard for cancer genome sequencing

  Dac EGAC00001000408

• ATACseq

  ATACseq data for this study.

  Study EGAS00001007166

• SNParray

  SNP array study for UTUC

  Study EGAS00001004979

• Sequencing data for oesophageal and related samples - OACs release 4 (RNA)

  Dataset EGAD00001004021

• Leukemia WGS data

  Whole-genome sequencing data from 38 leukemia patients and 12 leukemia cell lines; Containing 100 fastq files; Two files for each sample.

  Dataset EGAD00001008659

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• Exome sequencing reads of paediatric glioblastoma

  Whole exome sequencing of paediatric glioblastoma with mutations reported in the manuscript: Mutations in ACVR1, FGFR1 and TP53 associate with tumor location in histone H3 K27M pediatric midline high-grade astrocytoma

  Dataset EGAD00001000792

• TONIC study Whole Exome Sequencing

  Paired-end whole exome sequencing of 50 TNBC breast cancer metastasis samples and matched normal samples obtained from 50 unique patients assayed at study baseline (directly after patient randomization). The included raw sequencing data (fastq-format) were generated using Illumina HiSeq2500 instruments.

  Dataset EGAD00001004857

• Single RNA-Seq of fCAB treated tRNAs from VDH01

  Single RNA-seq of fCAB treated tRNAs from vdh01 samples (5 replicates). tRNAs were extracted using Mirvana° Invitrogen kit. The samples were prepped with Il TruSeq Small RNA and sequenced on Illumina NextSeq550.

  Dataset EGAD00001008743

• Whole exome sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region WES from 4 NSCLC patients, totaling 12 tumor samples and 4 matched control samples. The files were submitted as bam files.

  Dataset EGAD00001008382

• Molecular determinants of outcomes in relapsed mantle cell lymphoma treated with ibrutinib or temsirolimus in the MCL3001 (RAY) trial

  234 BAM files containing capture data of MCL tumours and constitutive DNA

  Dataset EGAD00001008975

• cfDNA dataset for cfDNA cohort

  Cell free DNA sequencing data for 233 samples across multiple cancer types for cfDNA cohort

  Dataset EGAD50000000104

• Targeted sequencing analysis for MDS with HSCT

  Targeted capture sequencing for cases with MDS who were subjected to unrelated bone marrow transplantation via Japan marrow donor program

  Study EGAS00001001949