19073 results for "Buy fc coins Buyfc26coins.com is EA Sports official for FC 26 coins They are the best FC seller..nEoY"

in 43.15 milliseconds.

• Molecular Profiles of BRCA1-Associated Ovarian Cancer Treated by Platinum-Based Therapy

  Whole-exome sequencing data from Illumina NextSeq 500. It consists of 88 paired-end FASTQ files from 44 primary, residual, relapsed tumors and normal samples from the blood.

  Dataset EGAD00001005470

• WES data from optic atrophy study

  The dataset includes Fastq files from WES experiments performed on a proband presenting with syndromic optic atrophy and his healthy parents. Exons were captured by hybridization and sequenced on an Illumina platform

  Dataset EGAD00001005321

• cHCC-ICC WES

  The whole exome sequencing data of 291 tumor/normal samples from 121 cHCC-ICC cases.

  Dataset EGAD00001005183

• Whole exome sequencing of Finnish hereditary breast cancer families

  Dataset contains Whole Exome Sequencing(WES) data from 37 individuals as aligned bam-files. The reads have been aligned using bowtie2 to human genome hg19 build.

  Dataset EGAD00001002133

• Xenograft BC WGS Dataset

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001336

• BASIS RNAseq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in 500 cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001264

• HIPO blastemal Wilms (nephroblastoma) CHIP sequencing samples

  HIPO blastemal Wilms (nephroblastoma) characterisation of tumor driving events caused by differential SIX1 binding of the SIX1 Q177R mutatns

  Dataset EGAD00001000992

• Copy number profiling using PlasmaSeq

  In order to establish copy number profiles from the various samples we prepared libraries and subjected them to whole-genome sequencing at a shallow sequencing depth (0.1x)

  Dataset EGAD00001000761

• RNA sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000285

• EGAD00000000057

  WTCCC project samples from the Parkinson's disase cohort

  Dataset EGAD00000000057

• FusionSeq: a modular framework for finding gene fusions by analyzing Paired-End RNA-Sequencing data

  We have developed FusionSeq to identify fusion transcripts from paired-end RNA-sequencing. FusionSeq includes filters to remove spurious candidate fusions with artifacts such as misalignments or random pairing of transcript fragments and it ranks candidates according to several statistics. It also has a module to identify exact sequences at breakpoint junctions. FusionSeq detected known and novel fusions in a specially sequenced calibration data set, including 8 cancers with and without known rearrangements.

  Study phs000311

• Spatial omics analysis of non-small cell lung cancers for revealing molecular statuses of intratumor heterogeneity and tumor microenvironment

  In this study, we perform spatial transcriptome analysis Visium/Xenium and other omics analysis using surgical specimens of Japanese non-small cell lung cancer cases to understand omics statuses of cancer cells and their surrounding stromal and immune cells in local tumor regions. We aim to stratify lung cancer patients with considering intratumor heterogeneity and complicated microenvironent of lung cancer tissues by using spatial omics data and histopathological information.

  Study JGAS000613

• EGAD00010000768

  Replication data for HipSci normal samples using both HumanCoreExome-12_v1 and HumanOmni2.5-8 BeadChips

  Dataset EGAD00010000768

• Sequencing data from a phase II study of nivolumab and ipilimumab in recurrent or refractory cancer of unknown primary (CheCUP trial)

  Sequencing data from a phase II study of nivolumab and ipilimumab in recurrent or refractory cancer of unknown primary (CheCUP trial). Panel sequencing data from baseline FFPE biopsies were used to perform a comprehensive genomic profiling of CUP metastases. Combined targeted next-generation sequencing of patient-specific hotsport mutations and shallow whole genome sequencing of baseline and follow-up liquid biopsy samples were used to analyze ctDNA and to evaluate response to immunei checkpoint inhibitor treatment. In some cases, whole exome sequencing of peripheral blood mononuclear cells was performed to screen for potential CHIP and germline mutations.

  Dataset EGAD00001011130

• Single cell RNA-seq and ATAC-seq of human fetal forebrain tissue, weeks 8 to 11.

  Single cell RNA-seq from 6 and single nuclei ATAC-seq from 3 human fetal tissue samples. Samples from 8 to 11 weeks. Includes a 8.5 weeks samples with matching both ATAC-seq and RNA-seq runs. Data was sequenced using 10X Genomics chromium technology, for scRNA-seq samples belong to v2 and v3.

  Dataset EGAD00001008653

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• The temporal mutational and immune tumour microenvironment remodelling of HER2-negative primary breast cancers

  WES and clonality characterization of different timepoints in HER2-negative primary breast cancers receiving neoadjuvant eribulin therapy.

  Study EGAS00001004953

• PacBio HiFi whole-genome sequencing of two microsatellite instability (MSI) gastric cancer

  We generated long-read whole-genome sequencing (WGS) data using PacBio HiFi from two human gastric cancer cell lines exhibiting microsatellite instability (MSI). The dataset contains aligned bam (hg38) files.

  Dataset EGAD50000002300

• Spatially resolved targetted sequencing of colorectal cancers

  Sequencing of laser-capture micro dissected colorectal tumour glands using a targeted capture panel. Tumours were previously subjected to WGS in the parent EPICC study. UMI-resolved aligned bam files, aligned to hg38.

  Dataset EGAD50000001650

• single cell transcriptomics fastq files from PBMC of long COVID patients

  This dataset consists of 8 patients' data fastq files. 4 in each LR1 and 4 in LR2. the dataset was generated using 10X genomics and novaseqX.

  Dataset EGAD50000001730

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Long-read RNA-seq from 5 patients with stereotyped subset CLL

  Oxford Nanopore Technologies based long-read RNA sequencing data from 5 patients with stereotyped subset CLL. The BAM files were aligned against hg19 reference genome.

  Dataset EGAD50000000755

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236