20313 results for "Fc coins Buyfc26coins.com is EA Sports official for FC 26 coins They are efficient and quick always..Z2Xg"

in 36.50 milliseconds.

• RNA-seq

  Bulk RNA-seq data of 8 RNA samples were generated. Libraries were prepared using the Stranded mRNA Library Prep, Ligation Kit (Illumina) following manufacturer’s recommendations and sequenced on a NextSeq 2000 (2x50 bp, Illumina).

  Dataset EGAD00001010308

• Single-cell CITE-seq from MDS patients with SF3B1 mutations

  Single-cell CITE(cellular indexing of transcriptomes and epitopes)-seq from MDS (n = 2, MDS02 in 2 replicates). cDNA from 10x Genomics 3' V3.

  Dataset EGAD00001011281

• Tumor-associated preferred end coordinates and somatic variants as signatures of circulating tumor DNA

  Plasma DNA libraries were constructed from 4 mL of plasma without library enrichment, namely without PCR amplification. Paired-end massively parallel sequencing was performed

  Dataset EGAD00001004561

• Locally advanced rectal cancer samples

  Fastq files from exome sequencing of paired normal/tumor (pre and post-nCRT) samples from 7 patients with rectal tumors. All samples were sequenced on a 5500xl SOLiD sequencing platform (Thermo Fisher Scientific).

  Dataset EGAD00001004378

• Copy number profiling using PlasmaSeq

  In order to establish copy number profiles from the various samples we prepared libraries and subjected them to whole-genome sequencing at a shallow sequencing depth (0.1x)

  Dataset EGAD00001000761

• whole genome sequencing

  Whole-genome sequencing was performed by Illumina Inc (San Diego, CA). Libraries were constructed with ~300bp insert length and paired-end 100bp reads were sequenced on Illumina HiSeq2000.

  Dataset EGAD00001000782

• BASIS RNAseq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in 500 cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001264

• Xenograft BC WGS Dataset

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001336

• Cell lines with telomere fusion-induced rearrangements

  Whole-genome somatic rearrangement and point mutation analysis in cell lines with induced telomere fusions.

  Dataset EGAD00001001629

• Molecular Profiles of BRCA1-Associated Ovarian Cancer Treated by Platinum-Based Therapy

  Whole-exome sequencing data from Illumina NextSeq 500. It consists of 88 paired-end FASTQ files from 44 primary, residual, relapsed tumors and normal samples from the blood.

  Dataset EGAD00001005470

• Epigenetic subtypes of neuroblastoma - RNAseq

  In the absence of recurrent gene mutations, evidence accumulates that epigenetic deregulation plays a prominent role in neuroblastoma biology. Here we provide RNAseq profiles in 71 primary and relapse neuroblastoma samples.

  Dataset EGAD00001006286

• BAM files of evolution T-ALL adults project

  WGS BAMs of 19 adult patients with T-acute lymphoblastic leukemia with primary, remission and relapse sample per patient. Total = 58 samples sequenced with HiSeq 4000 or NovaSeq 6000 (Illumina).

  Dataset EGAD00001006543

• Adult B-precursor acute lymphoblastic leukemia transcriptomes

  Bone marrow or peripheral blood samples were collected of adult patients at first diagnosis of B-precursor acute lymphoblastic leukemia. RNA was isolated from mononuclear cells and subjected to mRNA library prep using Poly-A selection and sequencing on a NovaSeq 6000 system. Obtained gene expression profiles and gene fusion calls were used to allocate samples to molecular disease subtypes.

  Dataset EGAD00001008633

• WGS of HSPC clones of healthy individual sequenced with Illumina NovaSeq 6000

  Dataset contains WGS sequecing data from clonally expanded hematopoietic stem cells from 7 individual pediatric cancer patients. Samples were taken before (DX - diagnosis) or Follow-up (DX2/REM/FU - Diagnosis 2, remission or follow-up, respectively). In addtion, cord blood clones (Designated CB) treated with X-ray radiation, Cisplatin, Maphosphamide, Vincristine and Doxorubicin and untreated cord blood hematopoietic stem/progenitor cells were have been whole-genome sequenced. (Abbreviations RAD, CISPL, MAPH, VINC, DOX and CTRL, respectively)

  Dataset EGAD00001007078

• RNA-seq data

  RNAseq FASTq files of 181 bulk pre-treatment and 14 post-treatment tumors from GO30140 Ph1b group A and F and 177 bulk pre-treatment tumors of IMbrave150 PhIII

  Dataset EGAD00001008128

• Solve RD data - Short-Read Whole-Genome Sequencing, raw data, tuh-kounap_group samples

  Solve-RD SR-WGS data generated for 3 samples provided by the group tuh-kounap

  Dataset EGAD00001015514

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Single-cell RNAseq data from 6 Invasive Lobular Carcinoma (ILC)

  Fastq files of single-cell RNAseq data from from Cancer Associated Fibroblasts (CAFs), cancer cells and immune cells isolated from 6 primary Invasive Lobular Carcinomas (ILCs)

  Dataset EGAD50000001121

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• ADAPTeR Study: scRNA/TCRseq data from ccRCC patients

  ADAPTeR study scRNA and scTCR data from TILs from two ccRCC patients treated with nivolumab

  Dataset EGAD00001008166

• CASCADE tumour transcriptome data

  RNA-Seq data from 20 fresh-frozen postmortem samples from three patients who participated in the CASCADE rapid autopsy program and died of metastatic castration resistant prostate cancer.

  Dataset EGAD00001009492

• Single-cell transcriptome of T-ALL PDX under drug treatment

  PDX model of T-ALL under treatment of CB-103 and Vehicle was analyzed by single-cell transcriptomics using 10X Genomics technology.

  Dataset EGAD00001009172