3743 results for "RNA AND sequencing OR transcriptome"

in 10.48 milliseconds.

• RNA sequencing of primary B-cells infected with Epstein-Barr virus (EBV), treated with heat-inactivated EBV, CpG or BCR-crosslinking in presence or absence of Linrodostat

  B cells were isolated from buffy coat preparations of healthy donors using CD19 magnetic beads. B cells were then infected with EBV using spinoculation or activated with heat-inactivated EBV, respectively. Additionally cells were treated with 5ng/ml CpG or a BCR-crosslinking mixture in presence or absence of 10 µM Linrodostat (IDO1 inhibitor). RNA samples were isolated at 2 days post-infection / post-activation and one day 0 control with non-infected B cells was included.

  Dataset EGAD50000000306

• Hypothalamic transcriptome in Prader-Willi syndrome

  Transcriptional analysis of brain tissue from people with molecularly defined causes of obesity may highlight novel disease mechanisms and therapeutic targets. Prader-Willi syndrome (PWS) is a genetic obesity syndrome characterised by severe hyperphagia. We performed RNA sequencing of the hypothalamus from 4 individuals with PWS and 4 age-matched controls.

  Study EGAS00001002901

• Facioscapulohumeral dystrophy transcriptome signatures correlate with different stages of disease and are marked by different MRI biomarkers

  This project includes RNA-sequencing data from human FSHD and control skeletal muscle biopsies. This project includes data from 28 FSHD patients (total 37 samples, including vastus lateralis and tibialis anterior muscles) and 12 control individuals (total 24 samples, including vastus lateralis and tibialis anterior muscles).

  Study EGAS00001005782

• RNA-seq Revision

  The dataset comprises bulk RNA‑seq libraries generated on the Illumina NextSeq 500 platform, including primary human hepatocytes (four donors), colon tissue (four masked replicates), and a comprehensive set of iPSC‑derived samples from the JHU106, ChiPSC18, ChiPSC22, and H9 lines. The collection covers multiple differentiation stages from iPSC to DE to HLC and cultivation protocols (CEL, HAY, SPH) with at least three replicates per condition. All sequencing data are provided as raw FASTQ files, with colon samples delivered as masked FASTQ in accordance with patient consent requirements.

  Dataset EGAD00001008951

• RNA sequencing of CD8 T cells from melanoma patients prior to and during checkpoint immunotherapy and untreated healthy controls

  We are interested in inter-individual variation in transcriptional response to immune checkpoint blockade. We have analysed poly A purified RNA expression from CD8 T cells (297 transcriptomes in total) isolated from metastatic melanoma patients (n=106) prior to and during treatment with either single agent (Pembrolizumab) or combination (Ipilimumab/ Nivolumab) immune checkpoint blockade. We compare expression at different stages of treatment and additionally contrast this with that from healthy controls (n=68).

  Dataset EGAD00001005973

• RNA-seq study of human long-term and short-term hematopoietic stem cells from umblical cord blood with lentiviral overexpression of S1PR3

  To investigate the molecular and biological pathways altered by S1PR3OE in human hematopoietic stem cells (HSC), we performed RNA-sequencing (RNA-seq) of LT- and ST-HSC 3 days after transduction with control or S1PR3 overexpression (OE) lentiviral vectors. LT-HSC and ST-HSC from 3 pool of CB lin- were FACS-purified, cells were prestimulated for 4 hours and transduced with lentiviral vectors. At day 3, 2000-5300 BFP+ cells were FACS-purified for RNA isolation with a PicoPure kit. We were able to isolate only 1600-1800 BFP+ cells from LT-HSC control samples as opposed to 4000-5400 BFP+ cells from S1PR3OE samples. Thus, we pooled all control BFP+ LT-HSC cells into one sample for RNA-seq analysis. BFP- LT-HSC from control vector transduction were purified from CB1 as an additional LT-HSC control. Nextera libraries generated from 10 ng RNA from 5 LT-HSC samples (2 controls, 3 S1PR3OE) and 6 ST-HSC samples (3 controls, 3 S1PR3OE) were subjected to 125 bp, paired-end RNA-sequencing on the Illumina HiSeq 2500 with an average of 50 million reads/sample at the Center for Applied Genomics, Sick Kids Hospital.

  Dataset EGAD00001006582

• Single-Cell DNA and RNA Sequencing over A 29-Year Period of A CLL Patient Demonstrating Evolution of Multiple Cell Clones

  Chronic lymphocytic leukemia (CLL) is a frequent B-cell malignancy characterized by recurrent somatic chromosome alterations and a low level of point mutations. Here we present single nucleotide polymorphism (SNP) microarray analyses of a single CLL patient over 29-years of observation and treatment, and transcriptome and whole genome sequencing at selected timepoints. We identified chromosome alterations of 13q14-, 6q- and 12q+ in early cell clones, elimination of clonal populations following therapy, and subsequent appearance of a clone containing trisomy 12 and a chromosome 10 copy neutral loss of heterogeneity (LOH) that marks a major population dominant at death. Serial single cell RNA sequencing revealed elevated mRNA expression of the FOS, JUN and KLF4 genes just before the appearance of acute disease requiring therapy. This gene expression pattern became undetectable following therapy, but reoccurred following relapse. Transcriptome evolution indicates that complex expression changes occur over time. In conclusion, CLL can evolve gradually during indolent phases, and undergo rapid changes following therapy.

  Study phs001181

• WES and RNA-seq of triple-negative breast cancers from the MyBrCa cohort

  The dataset contains a genomics characterization of 35 triple-negative Asian breast tumours from the Malaysian Breast Cancer cohort. This includes whole-exome sequencing of tumour tissue at 80X, whole-exome sequencing of matched normal (blood) tissue at 40X, and RNA-seq of tumour tissue at 40X coverage (>15 million reads). Whole-exome libraries were prepared using the Nextera Rapid Capture Exome Kit; exome capture was performed in pools of 3 and subjected to paired end 75 sequencing on a NovaSeq 6000 platform. RNA libraries were prepared using the TruSeq Stranded Total RNA HT kit with Ribo-Zero Gold as per manufacturer’s instructions and also subjected to paired end 75 sequencing on a NovaSeq 6000 platform. Uploaded bam files have been mapped to the hs37d5 human genome and processed using the standard GATK pipelines. Paired clinical, demographic, genotyping, and overall survival data for these patients are available from the associated publications or by request.

  Dataset EGAD00001009311

• Molecular Characterization of Prostate Cancer Specimens by Bulk and Single Cell Analysis

  Version 1: We performed single-cell RNA-sequencing (scRNA-seq) of fresh biopsies from metastatic castration resistant prostate cancer. Additionally, where available, we performed matched bulk whole exome sequencing (WXS; tumor and normal paired) and whole transcriptome sequencing for the same individuals. We also performed bulk whole exome (WXS) and RNA-sequencing (RNA-Seq) from FFPE pre-treatment biopsies from patients with clinically localized high-risk prostate cancer.Version 2: We added data from a randomized phase 2 trial of radium-223 with or without pembrolizumab in patients with Metastatic Castration-Resistant Prostate Cancer (mCRPC) to bone. After enrollment, study participants underwent bone biopsy and were randomized 2:1 to receive radium-223 at 55 kBq/kg every 4 weeks + pembrolizumab at 200 mg every 3 weeks (Arm A, R223+P) or radium-223 at 55 kBq/kg every 4 weeks alone (Arm B, R223). Stratification factors were alkaline phosphatase ≥220 vs. Data generated includes bulk whole exome sequencing (WXS), ultra-low pass whole genome sequencing (WGS) at 0.1X coverage, and targeted-capture sequencing. The ultra-low pass sequencing was used as part of the selection criteria for the target capture sequencing. Note: Two subjects in this study are linked to phs001577 and phs000915 respectively.

  Study phs001988

• Single-cell RNA sequencing of sorted regulatory T cells

  Single-cell RNA sequencing of flow cytometry enriched CD4+ CD127- CD25+ regulatory T cells from 8 systemic lupus erythematosus patients (SLE_001 to SLE_007, and SLE_009) collected at baseline (day 0, before interleukin-2 immunotherpay) and day 5 (after 1 treatment cycle of interleukin-2 immunotherapy). Sorted immune cells were hash tagged and then stained with TotalSeq Human Universal Cocktail (Biolegend) before further processing for single-cell RNA sequencing using the 10X-Genomics platform (incl. generation of TCR libraries). Samples from patients SLE_001, SLE_002, SLE_004, SLE_006 were collected and processed on the first day of experiment (Day 1), and samples from patients SLE_003, SLE_005, SLE_007, SLE_009 on the second day of experiment (Day 2). On each day, samples were pooled and distributed to four lanes on the chromium controller. Run ID 245269 and ID 245270 identify samples sequenced on separate flow cells. Provided are raw sequencing files.

  Dataset EGAD50000000663

• Genomic analysis of pancreatic neuroendocrine tumour with MEN1, ATRX, or DAXX mutations

  This dataset includes 52 samples from 19 individuals with pancreatic neuroendocrine tumours. These samples were analyzed using RNA-sequencing, whole-exome sequencing, shallow (~0.3x) whole-genome sequencing, and a 21-gene panel targeted capture sequencing. Everything was sequenced using the Illumina HiSeq and is provided in BAM or FASTQ format.

  Dataset EGAD00001006001

• MuTHER_adipose_tissue_small_RNA_expression

  We investigate the naturally occurring variation of small RNA expression in conjunction with genetic and gene expression variation. We shall assess the variation in subabdominal fat tissue small RNA levels in 168 unrelated MuTHER individuals. Using gene expression data from the same samples, we can survey how much the small RNA expression contributes to the variance in gene expression profiles. We can also take advantage of the high density genotyping data on these samples to identify genetic associations of small RNA expression levels, and the downstream effect of the genetic variants in small RNA sequence. Previous small RNA sequencing efforts have also extended the repertoire of small RNAs, and we hope to potentially find additional small RNAs active in adipose tissue biology. Altogether, the project should provide an exciting view into small RNA biology in humans, and lead to development of new methodology for analysis of molecular phenotype data.

  Study EGAS00001000212

• A thymic ILC1-like progenitor with differentiation potential towards KIR+NKG2A- NK cells

  The dataset contains bulk RNA sequencing data from 12 pediatric thymus samples collected during cardiac surgeries. These samples represent immunologically healthy donors with a mean age of 6 months. The sequencing was performed using Illumina HiSeq4000, and the processed files are available in standard formats such as FASTQ.

  Dataset EGAD50000001120

• Human Neuroblastoma

  This dataset comprises single-nucleus transcriptomic profiles from 10 human neuroblastoma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001596

• Human Paraganglioma

  This dataset comprises single-nucleus transcriptomic profiles from 9 human paraganglioma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001689

• Epigenomics and Single-cell Sequencing Define Cellular Heterogeneity in Langerhans Cell Histiocytosis

  Epigenomic and transcriptomic analysis of Langerhans cell histiocytosis (LCH) biopsies. Single-cell RNA-seq (10x Genomics) of seven LCH biopsies. ATAC-seq data from four sorted cell populations (in duplicate) from one LCH biopsy.

  Dataset EGAD00001005280

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• Peripheral clonal expansion of T cells (scRNA-seq)

  Single-cell RNA-seq of tumor-infiltrating lymphocytes from 14 cancer patients before treatment, taken from tumor, normal adjacent tissue, and peripheral blood. Dataset consists of paired-end FASTQ files, including replicate libraries and runs.

  Dataset EGAD00001005464

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680