3662 results for "RNA AND sequencing OR transcriptome"

in 11.85 milliseconds.

• This dataset contains the Fastq files from the RNA sequencing

  Whole blood was stimulated Ex vivo with Heat Killed M abscessus and M haemophilum or left untreated with Saline for each individual Healthy Control and MH-infected participants

  Dataset EGAD50000001566

• Sequencing data for oesophageal and related samples - Mourikis et al (RNA)

  Data supporting: "Patient-specific detection of cancer genes reveals recurrently perturbed processes in esophageal adenocarcinoma." Mourikis et al. RNAseq (BAM files) 137 samples

  Dataset EGAD00001004776

• Transcriptomic profiling of RIRCD patient skeletal muscle, comparing recovered to affected disease phase.

  Illumina MiSeq total RNA sequencing profiles of skeletal muscle biopsies from patient F3/1M during affected disease phase (4 replicates: F3-1M_Affected_1, F3-1M_Affected_2, F3-1M_Affected_3, F3-1M_Affected_4) compared to recovered phase (F3-1M_Recovered_1, F3-1M_Recovered_2, F3-1M_Recovered_3, F3-1M_Recovered_4).

  Dataset EGAD00001006382

• RNAseq data

  Bulk RNAseq of sigmoid colon biopsies from healthy volunteers and ulcerative colitis patients. Subjects were treated with Placebo or IL-22Fc at different doses, and biopsies were collected at day 0 and day 30 post treatment and prepared for RNA sequencing.

  Dataset EGAD00001008816

• Islet RFX6 Study Manuscript Data

  This submission includes raw FASTQ files (for bulk RNA-seq and 10X joint snATAC+snRNA multiome profiling experiments), sample phenotype files, and genotypes for the data included in the manuscript.

  Dataset EGAD00001008777

• Total RNAseq in the sporadic ALS and healthy control motor cortex

  The motor cortex is the earliest affected brain region in ALS. This dataset contains total RNA sequencing (stranded, 2x101bp) data derived from the motor cortex of 11 sporadic ALS patients and 8 healthy controls.

  Dataset EGAD00001006022

• Sequencing data for oesophageal and related samples - Ng, Contino et al (RNA)

  Data supporting: "Interplay of processes shapes structural variations undergoing selection in oesophageal adenocarcinoma" Ng, Contino et al. RNAseq (BAM files) 214 oesophageal adenocarcinoma samples

  Dataset EGAD00001007809

• A novel subset of human CD33+ haematopoietic stem cells characterized at single-cell resolution

  This dataset comprises single-cell RNA sequencing of the human Lin-CD34+38-45RA-90+49f+ phenotype isolated from 2 normal cord donors. Library preparation was performed following a modified CEL-Seq2 protocol.

  Dataset EGAD00001003955

• Sequencing data for oesophageal and related samples - Alex Frankell et al (RNA)

  Data supporting: "The landscape of selection in 551 Esophageal Adenocarcinomas defines genomic biomarkers for the clinic." Frankell et al. RNAseq (BAM files) 116 tumours

  Dataset EGAD00001004423

• RNA sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region RNAseq from 4 NSCLC patients, totaling 12 tumor samples and 7 matched control samples.

  Dataset EGAD00001008482

• Postmortem Single Nuclei and Bulk RNA-seq data of the Motor Cortex and Spinal Cord for Healthy, C9ALS and sALS Patients

  This dataset contains both snRNA-seq and bulk RNA-seq data from 19 different patients, comprising of 9 healthy controls (4 Spinal Cord, 5 Motor Cortex) as well as 5 C9ALS patients and 5 sporadic ALS patients, each with paired data from the spinal cord and motor cortex. For the snRNA-seq data, fastq files containing the raw reads are provided, many of these samples were pooled for sequencing and subsequently require demultiplexing using SNPs using a tool such as freemuxlet. The paired bulk RNA-seq data (raw fastq files) can be used to acquire the ground truth per patient - a list of pooled samples can be found in map.txt. snRNA-seq data was produced using the 10X Genomics 3' v3 kit and bulk RNA-seq was produced using the Illumina TruSeq v2 kit.

  Dataset EGAD00001009686

• MuTHER_adipose_tissue_small_RNA_expression

  We investigate the naturally occurring variation of small RNA expression in conjunction with genetic and gene expression variation. We shall assess the variation in subabdominal fat tissue small RNA levels in 168 unrelated MuTHER individuals. Using gene expression data from the same samples, we can survey how much the small RNA expression contributes to the variance in gene expression profiles. We can also take advantage of the high density genotyping data on these samples to identify genetic associations of small RNA expression levels, and the downstream effect of the genetic variants in small RNA sequence. Previous small RNA sequencing efforts have also extended the repertoire of small RNAs, and we hope to potentially find additional small RNAs active in adipose tissue biology. Altogether, the project should provide an exciting view into small RNA biology in humans, and lead to development of new methodology for analysis of molecular phenotype data.

  Study EGAS00001000212

• Genomic analysis of pancreatic neuroendocrine tumour with MEN1, ATRX, or DAXX mutations

  This dataset includes 52 samples from 19 individuals with pancreatic neuroendocrine tumours. These samples were analyzed using RNA-sequencing, whole-exome sequencing, shallow (~0.3x) whole-genome sequencing, and a 21-gene panel targeted capture sequencing. Everything was sequenced using the Illumina HiSeq and is provided in BAM or FASTQ format.

  Dataset EGAD00001006001

• ICARUS-LUNG01 dataset

  A total of 46 frozen tumor biopsies underwent WES analysis, while 41 blood samples were used as germline controls.Tumor samples qualified for whole exome sequencing (WES) if they contained ≥10% tumor cells. For bulk RNA-seq, 20 paired baseline and on-treatment frozen tumor biopsies were analyzed. Tumor samples qualified if they contained ≥30% tumor cells.

  Dataset EGAD50000001014

• A thymic ILC1-like progenitor with differentiation potential towards KIR+NKG2A- NK cells

  The dataset contains bulk RNA sequencing data from 12 pediatric thymus samples collected during cardiac surgeries. These samples represent immunologically healthy donors with a mean age of 6 months. The sequencing was performed using Illumina HiSeq4000, and the processed files are available in standard formats such as FASTQ.

  Dataset EGAD50000001120

• Human Neuroblastoma

  This dataset comprises single-nucleus transcriptomic profiles from 10 human neuroblastoma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001596

• Human Paraganglioma

  This dataset comprises single-nucleus transcriptomic profiles from 9 human paraganglioma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001689

• Epigenomics and Single-cell Sequencing Define Cellular Heterogeneity in Langerhans Cell Histiocytosis

  Epigenomic and transcriptomic analysis of Langerhans cell histiocytosis (LCH) biopsies. Single-cell RNA-seq (10x Genomics) of seven LCH biopsies. ATAC-seq data from four sorted cell populations (in duplicate) from one LCH biopsy.

  Dataset EGAD00001005280

• Identification of molecule relationship between intravenous leiomyomatosis and uterus myoma

  Up to now, there are two hypothesis about the pathogenesis of the relationship of intravenous leiomyomatosis and uterine myoma. One theory suggests that the IVL comes from the smooth muscle cell in the vessel wall.The other theory indicates that the IVL derives from the uterine myometrium. However, limited to the technology, few studies have been deeply explore the underlying relation. In this study, we employ the RNA sequencing to explore the molecule relationship between IVL and uterus myoma. In order to identify the molecule relationship between IVl and uterine myoma we conducted transcriptome sequencing and bioinformaitc analysis

  Dataset EGAD00001003356

• RNA-seq as a tool for evaluating human embryo competence

  The majority of embryos that are created through IVF do not implant. One possibility for this inefficiency is an incomplete understanding of the molecular factors affecting embryo competence. Currently, the process of selecting an embryo for uterine transfer utilizes an ad-hoc combination of morphological criteria, the kinetics of development, and genetic testing for aneuploidy. However, no single criterion can ensure selection of a viable embryo. In contrast, RNA-sequencing of embryos could yield highly dimensional data, which may provide additional insight and illuminate the discrepancies among current selection criteria. Indeed, recent advances enabling the production of RNA-sequencing (RNA-seq) libraries from single cells have facilitated the application of this technique to the study of some transcriptional events in early human development. However, these studies have not assessed the quality of their constituent embryos relative to commonly used embryological criteria. Here, we perform proof-of-principle advancement to clinical selection procedures by generating high quality RNA-seq libraries from a trophectoderm biopsy as well as the remaining whole embryo. We combine state-of-the-art embryological methods with low-input RNA-seq to develop the first transcriptome-wide approach for use in future predictive embryology studies. Specifically, we demonstrate the capacity of RNA-seq as a promising tool in preimplantation screening by showing that biopsies of an embryo can capture valuable information content available in the whole embryo from which they are derived. Furthermore, we show that this technique can be used to generate a RNA-based digital karyotype, and to develop a foundational dataset for identifying candidate competence-associated genes. Together, these data establish the foundation for a future RNA-based diagnostic in IVF.

  Study EGAS00001003667

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Peripheral clonal expansion of T cells (scRNA-seq)

  Single-cell RNA-seq of tumor-infiltrating lymphocytes from 14 cancer patients before treatment, taken from tumor, normal adjacent tissue, and peripheral blood. Dataset consists of paired-end FASTQ files, including replicate libraries and runs.

  Dataset EGAD00001005464