3884 results for "RNA AND sequencing OR transcriptome"

in 14.68 milliseconds.

• HPS1 patient monocyte-derived macrophage and control macrophage RNAseq with and without infection

  4 HPS1 patient monocyte-derived macrophages and 4 controls were RNA sequenced at baseline and after Salmonella Typhimurium infection. We used paired end sequencing on an Illumina HiSeq 4000. Each sample was run on 3 lanes for sequencing depth, which we combined for our analysis.

  Dataset EGAD00001006978

• RNA-seq as a tool for evaluating human embryo competence

  The majority of embryos that are created through IVF do not implant. One possibility for this inefficiency is an incomplete understanding of the molecular factors affecting embryo competence. Currently, the process of selecting an embryo for uterine transfer utilizes an ad-hoc combination of morphological criteria, the kinetics of development, and genetic testing for aneuploidy. However, no single criterion can ensure selection of a viable embryo. In contrast, RNA-sequencing of embryos could yield highly dimensional data, which may provide additional insight and illuminate the discrepancies among current selection criteria. Indeed, recent advances enabling the production of RNA-sequencing (RNA-seq) libraries from single cells have facilitated the application of this technique to the study of some transcriptional events in early human development. However, these studies have not assessed the quality of their constituent embryos relative to commonly used embryological criteria. Here, we perform proof-of-principle advancement to clinical selection procedures by generating high quality RNA-seq libraries from a trophectoderm biopsy as well as the remaining whole embryo. We combine state-of-the-art embryological methods with low-input RNA-seq to develop the first transcriptome-wide approach for use in future predictive embryology studies. Specifically, we demonstrate the capacity of RNA-seq as a promising tool in preimplantation screening by showing that biopsies of an embryo can capture valuable information content available in the whole embryo from which they are derived. Furthermore, we show that this technique can be used to generate a RNA-based digital karyotype, and to develop a foundational dataset for identifying candidate competence-associated genes. Together, these data establish the foundation for a future RNA-based diagnostic in IVF.

  Study EGAS00001003667

• Mechanism of Decitabine response in MDS/AML patients

  The dataset includes single cell RNA sequencing data from 17 AML/MDS patients undergoing a decitabine clinical trial. In total 47 samples were interrogated using 10X genomics ChromiumTM 140 Single Cell 5' Reagent Kit. The dataset includes bam files for each sample generated using CellRanger with default parameters.

  Dataset EGAD50000001354

• Single-cell RNA-sequencing data of human iPSC-derived (hiPSC-derived) astrocytes, both alone and in co-culture with neurons, to define the molecular response of astrocytes to misfolded alpha-synuclein.

  Samples were derived from an human iPSC-derived astrocyte line, both alone and in co-culture with neurons +/- alpha-synuclein oligomer treatment.

  Dataset EGAD50000001110

• GBM Study Complete Raw Data

  Tumors from 173 GBM patients were analysed for somatic mutations to generate a personalized peptide vaccine targeting tumor-specific neoantigens. Exome libraries for 173 glioblastoma tumors and matched normal DNA were sequenced on Illumina platform, alongside total RNA from the tumors.

  Dataset EGAD50000000650

• Single-cell/single-nucleus RNA-seq of diffuse hemispheric gliomas, H3G34-mutant.

  9 DHG-H3G34 patient samples were sequenced by paired-end scRNA-sequencing using the Smart-Seq2 protocol on a NextSeq 500 sequencer (Illumina). Illumina bcl2fastq 1.5 was used for demultiplexing. This dataset contains the resulting 9,408 fastq files of 4,704 single cells/nuclei sequenced.

  Dataset EGAD50000000760

• single cell data from HPV-positive head and neck cancer patients receiving induction CTLA-4 and PD-1 immune checkpoint blockade

  Baseline and on-treatment tumor samples from human papillomavirus-positive oropharynx cancer patients receiving anti-CTLA-4 and anti-PD-1 immune checkpoint blockade were analyzed by single-cell RNA and TCR sequencing.

  Dataset EGAD50000000487

• RNAseq of preneoplasia lung adenocarcinoma

  RNA sequencing of 168 pulmonary samples including lung preneoplasia atypical adenomatous hyperplasia (AAH, N=38), adenocarcinoma in situ (AIS, N=22), minimally invasive adenocarcinoma (MIA, N=19) and invasive lung adenocarcinoma (ADC, N=38) and adjacent lung tissues (Normal, N=62).

  Dataset EGAD50000000395

• Sequencing data for oesophageal and related samples - BOs release 2 (RNA)

  Dataset EGAD00001003840

• A novel subset of human CD33+ haematopoietic stem cells characterized at single-cell resolution

  This dataset comprises single-cell RNA sequencing of the human Lin-CD34+38-45RA-90+49f+ phenotype isolated from 2 normal cord donors. Library preparation was performed following a modified CEL-Seq2 protocol.

  Dataset EGAD00001003955

• Total RNAseq in the sporadic ALS and healthy control motor cortex

  The motor cortex is the earliest affected brain region in ALS. This dataset contains total RNA sequencing (stranded, 2x101bp) data derived from the motor cortex of 11 sporadic ALS patients and 8 healthy controls.

  Dataset EGAD00001006022

• Transcriptomic profiling of RIRCD patient skeletal muscle, comparing recovered to affected disease phase.

  Illumina MiSeq total RNA sequencing profiles of skeletal muscle biopsies from patient F3/1M during affected disease phase (4 replicates: F3-1M_Affected_1, F3-1M_Affected_2, F3-1M_Affected_3, F3-1M_Affected_4) compared to recovered phase (F3-1M_Recovered_1, F3-1M_Recovered_2, F3-1M_Recovered_3, F3-1M_Recovered_4).

  Dataset EGAD00001006382

• RNA sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region RNAseq from 4 NSCLC patients, totaling 12 tumor samples and 7 matched control samples.

  Dataset EGAD00001008482

• Islet RFX6 Study Manuscript Data

  This submission includes raw FASTQ files (for bulk RNA-seq and 10X joint snATAC+snRNA multiome profiling experiments), sample phenotype files, and genotypes for the data included in the manuscript.

  Dataset EGAD00001008777

• Single cell RNA sequencing of colorectal cancer patients (KUL5)

  All libraries were sequenced on Illumina NextSeq or NovaSeq6000 until sufficient saturation was reached.

  Dataset EGAD00001008585

• TN

  In order to comprehensively investigate the genetic relationship between PTC tumors and benign nodules, we totally collected 127 fresh-frozen biopsies samples from 28 patients with concurrent thyroid benign nodule and PTC (n=20) or simple benign nodule (n=8). We carried out whole-exome sequencing on all the 127 biopsies samples and RNA-sequencing in total of 40 samples.

  Dataset EGAD00001003351

• MPM patients

  - RNA-sequencing data: 5 normal pleurae and 40 malignant pleural mesotheliomas - Targeted DNA-sequencing of the 165 genes included in the “Solid and Haematological tumors” panel (BRIGHTCore, Brussels, Belgium): 6 MPM samples. 2 FASTQ files for each sample (paired).

  Dataset EGAD00001008740

• Tumor gene expression profiles for the study "TGF-β attenuates tumour response to PD-L1 blockade by contributing to exclusion of T cells"

  RNA was extracted from formalin-fixed and paraffin embedded tumors of a large cohort of bladder cancer patients before treatment with anti-PD-L1. RNA was sequenced using a capture based approach (exome capture, RNA access).

  Dataset EGAD00001003977

• Single cell transcriptome sequencing of the developing human embryonic meninges

  There are no effective medical therapies for meningiomas, partly due to our limited understanding of their cellular origin and composition For this purpose, we generated data to make a comprehensive reference single cell and spatial transcriptomic atlas of human fetal meninges. Samples of meninges from human embryos of post-conceptional week (PCW) 5.0-13.0 were dissected and subject to 10Xgenomics chromium single cell RNA sequencing with the purpose of identifying cell types and gene expression programs for normal meninges development, Furthermore, this dataset should help discover cells of origin for meningiomas.

  Study EGAS50000000980

• FASTQ files of the polyA+ (oligo-dT) RNA-Seq dataset from the POPS SGA (Small for Gestational Age) samples and their matched controls.

  FASTQ files of the polyA+ (oligo-dT) RNA-Seq dataset from the POPS SGA (Small for Gestational Age) samples and their matched controls. The POP study placental biopsies were collected within 30 minutes of birth and flash frozen in RNAlater (ThermoFisher). For each biopsy, total placental RNA was extracted from approximately 5 mg of tissue using the “mirVana miRNA Isolation Kit” (Ambion) followed by DNase treatment (“DNA-free DNA Removal Kit”, Ambion). RNA quality was assessed with the Agilent Bioanalyzer and all the samples with RIN values ≥ 7.0 were used in the downstream experiments. RNA-libraries were prepared from 1g of total placental RNA with the TruSeq Stranded mRNA Library Prep Kit (Illumina) which captures polyA-tailed transcripts by oligo-dT beads, then pooled and sequenced (single-end, 50bp) using a Single End V4 cluster kit and Illumina HiSeq2500

  Dataset EGAD00001006304

• Alpha synucleinopathy spectrum - bulk RNA seq of prefrontal cortex

  Dataset corresponding to the bulk RNA seq dataset from prefrontal cortex for a total of N=44 samples. Tissue samples correspond to patients with different alpha synucleinopathies. Specifically, idiopathic Parkinson's disease (PD, N=20) monogenic PD caused by LRRK2 mutations (LRRK2-PD, N=7), multiple system atrophy (MSA, N=6) and neurologically healthy controls (N=11). RNA seq was carried out using ribosomal depletion. The totality of these samples were also sequenced using single nucleus RNA seq, and available within the same study as a separate dataset.

  Dataset EGAD50000000430

• Alpha synucleinopathy spectrum - single nucleus RNA seq of prefrontal cortex

  Single nucleus RNA seq dataset from prefrontal cortex of a total of N=46 individuals with alpha synucleinopathies and healthy controls. Tissue samples correspond to patients with Parkinson's disease (PD, N=20) monogenic PD caused by LRRK2 mutations (LRRK2-PD, N=7), multiple system atrophy (MSA, N=6) and neurologically healthy controls (N=13). RNA seq was carried out employing 10X Genomics Chromium. These samples were also sequenced using conventional bulk tissue RNA seq, and available within the same study as a separate dataset.

  Dataset EGAD50000000431

• Complex-I stratification of Parkinson's disease - single nucleus RNAseq

  Single nucleus RNA seq dataset for CI stratification of Parkinson's disease Single nucleus RNA seq dataset of prefrontal cortex tissue from a total of N=18 samples. Tissue samples correspond to patients with idiopathic Parkison's disease (PD) with varying levels of Complex-I activity (N=12) and neurologically healthy controls (N=6). Single nucleus RNA seq was carried out using 10X Genomics Chromium. This dataset corresponds to a subset of the samples sequenced using conventional bulk tissue RNA seq and available within this Study as a separate Dataset.

  Dataset EGAD50000000432

• Complex-I stratification of Parkinson's disease in the prefrontal cortex - bulk RNA seq

  Dataset corresponding to the bulk RNA seq dataset from prefrontal cortex for a total of N=98 samples. Tissue samples correspond to patients with idiopathic Parkison's disease (PD) with varying levels of Complex-I activity (N=79) and neurologically healthy controls (N=19). RNA seq was carried out using ribosomal depletion. A subset of these samples was additionally sequenced using single nucleus RNA seq and is available in the same Study as an additional Dataset.

  Dataset EGAD50000000433

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178