11936 results for "cancer rna-seq"

in 14.42 milliseconds.

• Childhood Cancer Model Atlas

  we establish a single-site collection of 243 cell lines, including 207 paediatric cancer cell lines representing 14 distinct extracranial and brain childhood tumour types. We subjected 164 paediatric cancer cell lines to multi-omic analyses across three dimensions (DNA-sequencing, RNA-sequencing, DNA methylation) to classify them based on clinically relevant molecular subtypes.

  Study EGAS00001006320

• SDR-seq_06_BCL

  Multiomic targeted scDNA-scRNA-seq (SDR-seq) of primary B-cell non-Hodgkin lymphomas. Aim is to link genomci variants to gene expression in single cells. Profiled two follicular lymphoma (FL) primary patient samples and one germinal center subtype diffuse large B-cell lymphoma (GCB) primary patient sample.

  Study EGAS50000000374

• RNA-seq of human iPSC-derived neurons to explore cellular phenotypes associated with schizophrenia.

  This dataset contains high-throughput RNA-sequencing of 12 samples, each sample comprising neural precursor cells derived from human induced pluripotent stem cells from individuals with and without the 16p13.11 microduplication (a copy number variant associated with a range of neurodevelopmental disorders). 4 samples derive from patients carrying the 16p13.11 microduplication, and 8 derive from unaffected family controls. RNA samples were processed to deplete rRNA using the TruSeq Stranded Total RNA with Ribo-Gold kit. Libraries were then sequenced using the NextSeq 500/550 High-Output v2 Kit on the Illumina NextSeq 550 platform, to produce 75 base pair paired-end sequencing reads at an average depth of around 100 million reads per sample. Raw sequencing reads data are stored in two FASTQ files per sample for these paired-end reads.

  Dataset EGAD00001004064

• WTS and WES of Renal Cell Carcinoma Tumors From a Phase III Anti-Angiogenic Adjuvant Therapy Trial

  Archival de-identified formalin-fixed paraffin-embedded RCC tumor tissue blocks from nephrectomy or tumor biopsy were processed as per below and the same sections were used for both DNA and RNA extractions. For WES (ACE version 3; Illumina NovaSeq), samples were profiled using Personalis ACE Cancer Exome (Personalis, Inc, Menlo Park, CA) Whole-transcriptome profiles were generated by RNA-seq (Accuracy and Content Enhanced (ACE) version 3; Illumina NovaSeq) using Personalis ACE Cancer Transcriptome (Personalis, Inc, Menlo Park, CA ) Of the 615 patients in the intent-to-treat population in S-TRAC trial, 193 individual specimens were available for molecular profiling, of which 171 (27.8%) (sunitinib, n = 91; placebo, n = 80) returned results for the WES analysis, and 133 (21.6%) (sunitinib, n = 72; placebo, n = 61) returned results for the GES analysis. Of the 138 WTS samples with data, replicates for two patients were summarized by median expression, and three samples were excluded from the final analysis due to low counts.

  Dataset EGAD00001009294

• Patient-Derived Breast Cancer Organoid Study

  This study uses normal and tumor tissues from breast cancer patients to derive 3D cell culture models called organoids. Organoid technology is an innovative platform that can be used to study a patient's tumor in a dish ex-vivo. As part of this study we have comprehensively characterized these models using next-generation sequencing for: 1) pathogenic SNVs in a targeted gene panel 2) copy number alterations 3) transcriptome analysis using RNA sequencing and 4) single-cell RNA sequencing

  Study phs002722

• Single cell RNAseq of PBMC from bladder cancer patients

  This dataset contains single cell RNA sequencing data of PBMC samples from 10 bladder cancer patients. cDNAs and single cell RNA libraries were prepared following manufacturer’s user guide (10x Genomics). Each library was sequenced in HiSeq4000 (Illumina) to achieve ~300 million reads following manufacturer’s sequencing specification.

  Dataset EGAD00001005481

• RNA sequencing of Korean ER positive breast cancer females aged under 35 years old.

  Corresponding data set is composed of RNA sequencing of Korean ER positive breast cancer under 35 years old. This set provides 50 alignment files of 50 tumor samples. This is a part of total project data set.

  Dataset EGAD00001003243

• Dual inhibition of FLT3 and BCL-2 is effective in preclinical models of BCL11B-activated lineage ambiguous leukemia

  Aberrant activation of BCL11B (“BCL11B-a”) defines a subtype of lineage ambiguous leukemias with T-lymphoid and myeloid features, co-occurring activating FLT3 mutations, and a stem/progenitor immunophenotype and gene expression profile. As with other lineage ambiguous leukemias, optimal treatment is unclear and there are limited targeted therapeutic options. Here, we investigated the efficacy of BCL-2 and FLT3 inhibition with venetoclax and gilteritinib, respectively, in preclinical models of BCL11B-a leukemia. Despite variation in response to single agent therapies, the combination of venetoclax plus gilteritinib was highly effective in all models evaluated. BH3 profiling and single cell RNA-seq analysis suggests that resistance to venetoclax and/or gilteritinib monotherapies is due to the tumor-intrinsic activity of BCL-xL and/or MCL-1 prior to drug treatment. These data support clinical evaluation of venetoclax in combination with gilteritinib in BCL11B-a lineage ambiguous leukemias.

  Study EGAS50000000978

• Monosomy 7 delineates a primitive acute myeloid leukemia with adverse prognosis and responsiveness to epigenetic therapy

  The mechanistic basis for adverse risk associated with monosomy 7 remains undetermined in AML. In contrast to del(7q), monosomy 7 conferred adverse prognosis independent of TP53 and complex karyotype. Single-cell RNA and ATAC-seq revealed an epigenetically remodeled landscape and expansion of multipotent progenitor (MPP)-like cells. Monosomy 7 derived progenitors were distinguished by reduced chromatin accessibility and expression of STK17A and NT5C3A, which conferred resistance to cytotoxic and venetoclax-based therapy. To circumvent resistance mediated by monosomy 7 and deficient TP53, histone deacetylase inhibitors (HDACi) effectively restored apoptotic potential and augmented the activity of venetoclax. In a randomized clinical trial including older unfit patients with AML and monosomy 7, responses were observed in the majority that received low-dose cytarabine, venetoclax and the HDACi pracinostat, some with durable remissions exceeding 3 years. Longitudinal studies highlighted diminution of MPP-like cells, linking epigenetic remodeling to clinical response and therapeutic vulnerability of monosomy 7 AML.

  Study EGAS50000001641

• Molecular Signatures of DCIS to Invasive Progression for Basal-Like Breast Cancers: An Integrated Mouse Model and Human Tumor Study

  We studied the genomic signatures of progression in breast ductal carcinoma in situ (DCIS) as it progresses towards triple negative invasive breast cancer (TNBC). Single cell RNA sequencing (scRNAseq) was performed on the C3Tag genetically engineered mouse model that forms human breast-like DCIS and TNBC. Bulk RNA sequencing was performed on RNA harvested from archival formalin-fixed, paraffin embedded (FFPE) pairs comprising of estrogen receptor (ER) positive (ER+) and negative (ER-) subsets of DCIS. 

  Study phs002443

• Poikiloderma_syndrome_RNAseq

  We will sequence the RNA of lymphoblast samples, transformed with EBV, which have poikiloderma syndrome with mutations in c16orf57. The aim of the experiment is to characterise RNA structural effects in this disease.

  Study EGAS00001000250

• Peripheral clonal expansion of T cells (scTCR-seq)

  Single-cell TCR-seq of tumor-infiltrating lymphocytes from 14 cancer patients before treatment, taken from tumor, normal adjacent tissue, and peripheral blood. Dataset consists of paired-end FASTQ files, including replicate libraries and runs.

  Dataset EGAD00001005465

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718