12310 results for "cancer rna-seq"

in 35.70 milliseconds.

• WTS and WES of Renal Cell Carcinoma Tumors From a Phase III Anti-Angiogenic Adjuvant Therapy Trial

  Archival de-identified formalin-fixed paraffin-embedded RCC tumor tissue blocks from nephrectomy or tumor biopsy were processed as per below and the same sections were used for both DNA and RNA extractions. For WES (ACE version 3; Illumina NovaSeq), samples were profiled using Personalis ACE Cancer Exome (Personalis, Inc, Menlo Park, CA) Whole-transcriptome profiles were generated by RNA-seq (Accuracy and Content Enhanced (ACE) version 3; Illumina NovaSeq) using Personalis ACE Cancer Transcriptome (Personalis, Inc, Menlo Park, CA ) Of the 615 patients in the intent-to-treat population in S-TRAC trial, 193 individual specimens were available for molecular profiling, of which 171 (27.8%) (sunitinib, n = 91; placebo, n = 80) returned results for the WES analysis, and 133 (21.6%) (sunitinib, n = 72; placebo, n = 61) returned results for the GES analysis. Of the 138 WTS samples with data, replicates for two patients were summarized by median expression, and three samples were excluded from the final analysis due to low counts.

  Dataset EGAD00001009294

• Dataset of 5 RNAseq from 3 non-muscle-invasive bladder cancer patients

  RNAseq (FASTQ files) of 5 tumor from 3 non-muscle-invasive bladder cancer patients. For patient UC2, RNA from 3 different synchronous tumors was extracted. Relating to the other datasets from the project : no RNA was available from patient UC4. NB : patients aliases are the following : ROXY : UC1, OMAD : UC2, MAKI : UC3, HAPE : UC4

  Dataset EGAD50000002009

• Human lymphoma plasma cfRNA - raw data

  This study contains total RNA sequencing data from plasma of 65 different human donors: 30 diffuse large B-cell lymphoma patients, 13 primary mediastinal large B-cell lymphoma patients and 22 cancer-free controls.

  Study EGAS00001007127

• Indonesian RNA-seq data

  Transcription data were collected to study patterns of functional variation across the broad geography of Indonesia. The region has extremely diverse populations, with very different demographic histories and multiple genetic ancestries. This dataset reports high-throughput RNA-sequencing data for individuals from three islands spanning this geographical region: Mentawai, Sumba and West Papua.

  Study EGAS00001003671

• Onco-exaptation of an Endogenous Retroviral LTR Drives IRF5 Expression in Hodgkin Lymphoma

  The transcription factor interferon regulatory factor 5 (IRF5) is upregulated in Hodgkin lymphoma (HL) and a key regulator of the aberrant transcriptome characteristic of this disease. Here we show that IRF5 upregulation in HL is driven by transcriptional activation of a normally dormant endogenous retroviral LOR1a long terminal repeat (LTR) upstream of IRF5. Specifically, through screening of RNA-seq libraries, we detected LTR-IRF5 chimeric transcripts in multiple HL cell lines but not in normal B-cell controls. In HL, the LTR was in an open and hypomethylated epigenetic state and we further show the LTR is the site of transcriptional initiation. Among HL cell lines, usage of the LTR promoter strongly correlates with overall levels of IRF5 mRNA and protein, indicating that LTR transcriptional awakening is a major contributor to IRF5 upregulation in HL. Taken together, oncogenic IRF5 overexpression in HL is the result of a specific LTR transcriptional activation. We propose that such LTR derepression is a distinct mechanism of oncogene activation (“onco-exaptation”) and that such a mechanism warrants further investigation in molecular and cancer research.

  Study EGAS00001001205

• Atezolizumab monotherapy following dCRT indicated a promising cCR rate in patients with unresectable locally advanced esophageal squamous cell carcinoma (EPOC1802)

  The objective is to analyze tumor and normal cell exome sequencing of esophageal cancer patients participating in the Tenergy trial before treatment and RNA sequencing specimens of tumor biopsy specimens at three points before treatment, after radiation chemotherapy, and after atezolizumab administration, in order to search for biomarkers to predict treatment response. Exome sequencing of pretreatment tumor tissue (27 specimens) and normal tissue (27 specimens) from esophageal cancer patients participating in the Tenergy trial, and RNA sequencing of tumor biopsy specimens at three time points before treatment (28 specimens), after radiation chemotherapy (25 specimens) and after atezolizumab administration (25 specimens).

  Study JGAS000708

• Evaluation of Local Response of Prostate Cancer to Irradiation Using Multiparametric MRI and MR-Guided Biopsies

  The purpose of this study was to determine the rate of local recurrence in patients with intermediate and high risk prostate cancer treated with radiotherapy. In this study, multiparametric MRI was first performed, and biopsy tissue was acquired from cancerous regions detected on MRI. Blood samples were also taken. DNA and RNA were extracted from tissue taken at baseline. DNA was used for whole exome sequencing (WES). RNA was used for gene expression microarray. Each patient then received radiation therapy with androgen deprivation therapy.

  Study phs001821

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107