11769 results for "cancer rna-seq"

in 11.28 milliseconds.

• LCM-RNAseq on human lung macrophages

  In the reported study, we employed Laser Capture Microdissection (LCM) for the transcriptome profiling of lung macrophages cells populations as a function of location within the healthy tissue. In detail, macrophage mini-bulks (100 cells each) were collected by LCM from 4 healthy human donors in 5 different locations of the airways (a total of 20 biopsies), including parenchyma (L1 – lower left lobe (LLL); L6 – 80% distance from LLL tip), trachea (L2), bronchi (L3 – 1st/2nd generation; L5 – 3rd/4th generation) and processed for RNA-seq.

  Study EGAS00001006168

• PEACE melanoma 14

  Understanding the evolutionary pathways to metastasis and resistance to immune checkpoint inhibitors (ICI) in melanoma is critical for improving outcomes. Here we present the most comprehensive intra-patient metastatic melanoma dataset assembled to date as part of the PEACE research autopsy programme, including exome, panel-sequenced, RNA-seq, and single-cell whole-genome sequencing samples from 14 ICI-treated patients. The main goals of the project are to decipher the evolutionary dynamics of melanoma metastases and to elucidate mechnisms of resistance to therapies.

  Study EGAS00001007081

• Single nuclei RNA-Seq from 5 regions of the human fetal brain

  Data generated through single nuclei RNA sequencing on 5 regions of the brain (frontal cortex, ganglionic eminence, hippocampus, thalamus and cerebellum) from 3 fetuses (two of 14 and one of 15 post-conception weeks, all female). Tissue was acquired from the MRC-Wellcome Trust Human Developmental Biology Resource (HDBR) with ethical approval. snRNA-seq libraries were prepared from ∼10,000 nuclei from each sample using Chromium Single Cell 3ʹ (v3) reagents (10X Genomics). Quality control of libraries was performed using the Agilent 5200 Fragment Analyzer before sequencing on an Illumina NovaSeq 6000 to a depth of at least 865 million (median = 1.01 billion) read pairs per library. Raw sequencing data were converted into FASTQ files. For a full description of data generation, please see Cameron et al, Biological Psychiatry 2022, https://doi.org/10.1016/j.biopsych.2022.06.033.

  Dataset EGAD00001009303

• BAM files of total RNA-Seq data of POPS control samples (GRCh37)

  Placental biopsies (n = 64 female placentas, n = 67 male placentas) were selected from healthy pregnancies from the POPs cohort. A quality control process was also applied for the RNA-Seq datasets: reads were trimmed with Trim Galore!, which uses cutadapt internally and were mapped to the same version of human genome reference (hg19). TopHat2, a splice-aware mapper built on top of Bowtie2 short-read aligner, was used in the mapping process in which so-called two-pass (or two-scan) alignment protocol was applied to rescue unmapped reads from the initial mapping step. In the second mapping, previously unmapped reads were re-aligned to the exon-intron junctions detected in the first-mapping by TopHat2 and were combined across all 131 placenta samples. The initial and second mapped reads were merged by samtools

  Dataset EGAD00001003462

• Transcriptome sequencing of cancer cell lines

  This dataset contains RNA sequencing data for 675 cancer cell lines. RNA libraries were made with the TruSeq RNA Sample Preparation kit (Illumina) according to the manufacturer protocol. The libraries were sequenced on an Illumnia HiSeq 2000

  Dataset EGAD00001000725

• BBMRI – BIOS – Freeze 2 – RNA-seq Counts

  Read counts determined using HTSeq-count for the BBMRI BIOS Freeze 2 RNAseq data

  Dataset EGAD00010001420

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562