12068 results for "cancer rna-seq"

in 17.94 milliseconds.

• Neutrophils and emergency granulopoiesis drive immune suppression and an extreme response endotype during sepsis

  This dataset contains raw sequencing files associated with the paper "Neutrophils and emergency granulopoiesis drive immune suppression and an extreme response endotype during sepsis" (https://doi.org/10.1038/s41590-023-01490-5). It is composed of two experiments, which are as follows: 1. Single-cell profiling of whole blood leukocytes: This experiment comprises sequencing files generated using the BD Rhapsody single-cell multi-omics profiling (RNA + protein) platform. This platform was used to profile the whole blood leukocyte population in a cohort of sepsis patients, cardiac surgery controls and healthy controls. There are 48 samples and four files per sample: two paired-end FASTQ files (R1 and R2) corresponding to the RNA-seq library, and two paired-end FASTQ files (R1 and R2) corresponding to the protein profiling (ADT-based AbSeq) library. 2. Single-cell profiling of circulating HSPCs: This experiment comprises sequencing files generated using the 10X single-cell multi-omics (RNA-seq + ATAC-seq) profiling platform. This platform was used to profile circulating HSPCs in a cohort of sepsis patients and healthy controls. There are 5 samples (or plexes), each of which consists of a pool of individuals for whom cells were multiplexed and sequenced as a single sample. There are four files per sample: two paired-end FASTQ files (R1 and R2) corresponding to the RNA-seq library, and two paired-end FASTQ files (R1 and R2) corresponding to the ATAC-seq library. Because these samples consists of multiplexed pools, index files are also provided. These can be used for sample deconvolution using the Cell Ranger pipeline. NOTE: Due to EGA's constrains in the number of files permitted per sample, index files (I1 and I2) for the HSPC data set are provided as a separate experiment named "FASTQ index files (I1 and I2) for deconvolution of 10X single-cell multiomics libraries".

  Dataset EGAD00001010927

• Single-cell RNA sequencing of breast cancer lung metastasis and adjacent normal tissue

  This dataset contains single-cell RNA sequencing data from two samples: L1 (breast cancer metastasis to lung) and N3 (adjacent normal lung tissue) from a female patient. The samples were processed using 10X Chromium 3' technology and sequenced on Illumina NextSeq 500. This data supports the study "Endocrine therapy reprogramming of breast cancer facilitates metastatic escape via upregulation of P-Rex1/Rac1 signalling" which investigates how endocrine therapy reprograms breast cancer cells, leading to upregulation of P-Rex1/Rac1 signalling pathways that facilitate metastatic escape. The single-cell analysis reveals cellular reprogramming mechanisms in endocrine therapy-resistant breast cancer cells that form metastases in the lung.

  Dataset EGAD00001015769

• LEF1 knockdown effects on human T cell transcriptome and chromatin accessibility profiles.

  LEF1 (Lymphoid Enhancer-Binding Factor 1) is a key transcription factor in T cell development and function, and its dysregulation has been implicated in various immune-related disorders. This study aimed to comprehensively characterize the transcriptional and epigenetic changes induced by LEF1 knockdown in human T cells. CD3+ T cells isolated from three healthy donors were transfected with either LEF1-specific siRNA or control siRNA, followed by activation with CD3/CD28 Dynabeads and culture in IL-2-containing media. Cells were harvested at 24, 48 and 72 hours post-transfection for multi-omics analysis including bulk RNA-seq, bulk ATAC-seq, single-cell CITE-seq (For CITE-seq, 48 and 72 hours only). This dataset provides insights into LEF1-dependent gene regulatory networks and chromatin accessibility patterns in activated human T cells, contributing to our understanding of T cell biology and potential therapeutic targets. This dataset is part of a comprehensive study investigating functional roles of risk polymorphisms in autoimmune diseases, particularly focusing on the rs58107865 variant at the LEF1 locus.

  Study JGAS000818

• BBMRI – BIOS – Freeze 2 – RNA-seq Counts

  Read counts determined using HTSeq-count for the BBMRI BIOS Freeze 2 RNAseq data

  Dataset EGAD00010001420

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107