11925 results for "cancer rna-seq"

in 12.23 milliseconds.

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• Single-cell RNA-sequencing reveals that glioblastoma recapitulates a normal neurodevetlopmental hierarchy

  We discovered a conserved neural tri- lineage cancer hierarchy centered around glial progenitor-like cells. We also found that this progenitor population contains the majority of the cancer’s cycling cells, and, using RNA velocity, is often the originator of the other cell types. Finally, we show that this hierarchal map can be used to identify therapeutic targets specific to progenitor cancer stem cells. Our analyses show that normal brain development reconciles glioblastoma development, suggests a possible origin for glioblastoma hierarchy, and helps to identify cancer stem cell-specific targets.

  Study EGAS00001004422

• Effects of 2DG, Galactose, or Oligomycin on the epigenome remodeling induce by T cells activation.

  T cell activation is known to require a metabolic shift towards glycolysis, triggered by TCR-engagement . To substantiate the role of glycolysis in transcriptional reprogramming during antigen-driven T cell activation, we utilized a well-established ex-vivo model to recapitulate the process of antigen stimulation without the requirement for additional antigen-presenting cells . We initially explored and validated the conditions for both metabolic and epigenetic reprogramming. Antigen-mediated CD4+ T cells activation initiates context-specific gene-expression programs that drive effector functions and cell fates through changes in the epigenetic landscape . To evaluate global changes in histone modifications, we isolated CD4+ T cells from peripheral blood (PB) of healthy control (HC) human donors and either maintained them in resting conditions or stimulated with anti-CD3/CD28 for 24h. Rapid changes in the CD4+ epigenome and transcriptome were observed within 24h as measured by RNA-sequencing (RNA-seq) and H3K27ac chromatin immunoprecipitation followed by DNA-sequencing (ChIP-seq).To explore the requirement for metabolic reprogramming in regulating transcriptional responses after initial TCR engagement, CD4+ T cells from PB of healthy donors were isolated and activated in either the presence or absence of oligomycin (inhibitor of ATP synthase blocking the production of ATP by OXPHOS), 2-deoxyglucose (2DG; competitively inhibiting production of glucose-6-phosphate from glucose), or replacement of glucose with galactose. Galactose is metabolized through glycolysis, utilizing the Leloir pathway which is energy neutral, forcing cells to use all the pyruvate production to sustain the TCA cycle for OXPHOS and ATP synthesis at the expense of lactate production. Employing ChIP-seq and RNA-seq, inhibition of OXPHOS-mediated ATP production by oligomycin had only a limited effect on H3K27-acetylation or activation-induced transcription during the first 24h of activation. In contrast, inhibition of glycolysis by 2DG treatment compromised both H3K27-acetylation and transcriptional changes. However, under conditions of galactose-metabolism where lactate production is abrogated, activated CD4+ T cells were still able to globally remodel H3K27 acetylation and reprogram the transcriptome.

  Study EGAS00001007115