12069 results for "cancer rna-seq"

in 26.36 milliseconds.

• Illumina single-cell RNA sequencing of omentum biopsies of ovarian cancer patients

  Illumina Novaseq paired-end single-cell RNA sequencing samples prepared using 10X Genomics platform. 3 ovarian cancer patients, 5 omentum biopsies samples: 3 HGSOC metastasis samples (one per patient), 2 healthy samples (one per patient except Patient2). 4 paired fastq files per sample.

  Dataset EGAD00001009815

• Triple Negative Breast Cancer RNA Sequencing

  We propose to definitively characterise the somatic genetics of triple negative breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000390

• Sequencing data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Repli-seq data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Dataset EGAD00001015363

• RNA sequencing data of 66 matched primary and recurrent high grade serous ovarian cancer

  Dac EGAC00001000741

• Targeted RNA sequencing of breast cancer GWAS loci

  Dataset EGAD00001004498

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774