11932 results for "cancer rna-seq"

in 15.65 milliseconds.

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• Single-cell RNA-sequencing reveals that glioblastoma recapitulates a normal neurodevetlopmental hierarchy

  We discovered a conserved neural tri- lineage cancer hierarchy centered around glial progenitor-like cells. We also found that this progenitor population contains the majority of the cancer’s cycling cells, and, using RNA velocity, is often the originator of the other cell types. Finally, we show that this hierarchal map can be used to identify therapeutic targets specific to progenitor cancer stem cells. Our analyses show that normal brain development reconciles glioblastoma development, suggests a possible origin for glioblastoma hierarchy, and helps to identify cancer stem cell-specific targets.

  Study EGAS00001004422

• Effects of 2DG, Galactose, or Oligomycin on the epigenome remodeling induce by T cells activation.

  T cell activation is known to require a metabolic shift towards glycolysis, triggered by TCR-engagement . To substantiate the role of glycolysis in transcriptional reprogramming during antigen-driven T cell activation, we utilized a well-established ex-vivo model to recapitulate the process of antigen stimulation without the requirement for additional antigen-presenting cells . We initially explored and validated the conditions for both metabolic and epigenetic reprogramming. Antigen-mediated CD4+ T cells activation initiates context-specific gene-expression programs that drive effector functions and cell fates through changes in the epigenetic landscape . To evaluate global changes in histone modifications, we isolated CD4+ T cells from peripheral blood (PB) of healthy control (HC) human donors and either maintained them in resting conditions or stimulated with anti-CD3/CD28 for 24h. Rapid changes in the CD4+ epigenome and transcriptome were observed within 24h as measured by RNA-sequencing (RNA-seq) and H3K27ac chromatin immunoprecipitation followed by DNA-sequencing (ChIP-seq).To explore the requirement for metabolic reprogramming in regulating transcriptional responses after initial TCR engagement, CD4+ T cells from PB of healthy donors were isolated and activated in either the presence or absence of oligomycin (inhibitor of ATP synthase blocking the production of ATP by OXPHOS), 2-deoxyglucose (2DG; competitively inhibiting production of glucose-6-phosphate from glucose), or replacement of glucose with galactose. Galactose is metabolized through glycolysis, utilizing the Leloir pathway which is energy neutral, forcing cells to use all the pyruvate production to sustain the TCA cycle for OXPHOS and ATP synthesis at the expense of lactate production. Employing ChIP-seq and RNA-seq, inhibition of OXPHOS-mediated ATP production by oligomycin had only a limited effect on H3K27-acetylation or activation-induced transcription during the first 24h of activation. In contrast, inhibition of glycolysis by 2DG treatment compromised both H3K27-acetylation and transcriptional changes. However, under conditions of galactose-metabolism where lactate production is abrogated, activated CD4+ T cells were still able to globally remodel H3K27 acetylation and reprogram the transcriptome.

  Study EGAS00001007115

• Perturb-seq dataset

  We performed a systematic, genome-wide investigation of enhancer regions in colorectal cancer (CRC). We identified 12,117 putative enhancer regions using H3K27ac and H3Kme1 ChIP-seq and ATAC-seq. We performed scRNA-seq in HT29 and SW480 (MSS CRC cell lines) using the Parse Biosciences WT-mega kit with CRISPRi/dCas9 inhibition of these regions (Perturb-seq). The Parse split-pipe pipeline was used to demultiplex the raw fastq files into the processed files (mtx files for genes and gRNA) for each cell line.

  Dataset EGAD50000000375

• RNA sequencing in primary inflammatory (TPP) macrophages following deletion of a disease-associated gene desert at chr21q22, disruption of ETS2, or treatment of ETS2-edited macrophages with a HIF1α stabiliser.

  This dataset comprises raw RNA sequencing data (FASTQs) from primary inflammatory (TPP) macrophages that were unedited (non-targeting control, NTC), edited to delete the disease-associated chr21q22 enhancer region (n=5), or edited to disrupt ETS2 with 1 of 2 independent gRNAs (n=9). We also performed RNA-sequencing in NTC or ETS2-edited TPP macrophages that were treated for 12 hours with vehicle (DMSO) or roxadustat (30 uM, n=3). Macrophages were detached using Accutase and lysed. RNA was extracted from cell lysates using an AllPrep DNA/RNA Mini Kit (Qiagen). Sequencing libraries were prepared from 10ng RNA using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara) following the manufacturer’s instructions. The quality and molarity of all libraries was assessed using a BioAnalyzer 2100 and the libraries were sequenced on a NextSeq500. Raw data are provided as 50 bp paired-end Illumina reads.

  Dataset EGAD00001011338

• High-Throughput RNA Isoform Sequencing using Programmable cDNA Concatenation

  MAS-ISO-seq is a novel technique for programmably concatenating cDNAs into single molecules for optimal long-read sequencing. In practice, this boosts throughput >15 fold to nearly 40 million cDNA reads per run on the PacBio Sequel IIe sequencer. We have validated this method via application to synthetic RNA isoforms and single-cell sequencing of tumor-infiltrating T cells. Results demonstrated a >30 fold boosted discovery of differentially spliced genes and robust cell clustering, as well as canonical PTPRC splicing patterns across T cell subpopulations and the concerted expression of the associated hnRNPLL splicing factor.

  Study phs003200

• Neuroblastoma patient Total RNA Seq data

  Tumor Total RNA Seq data of primary neuroblastomas. This is an update of the „Berlin Neuroblastoma Dataset” (EGAS00001004022). This data was used for the analysis of circular RNA expression and regulation in neuroblastoma.

  Dataset EGAD00001008124

• HiDEF-seq Single-Molecule Sequencing of Single-Strand Mismatches and Damage

  Our study sought to resolve, with single-molecule resolution, the mismatches and damage events that precede DNA mutations. Using a novel single-molecule, long-read sequencing method (HiDEF-seq) we detected base substitutions when present in either one or both DNA strands. We compared the fidelity for dsDNA mutations to that of the same samples profiled by NanoSeq duplex sequencing. We also detected cytosine deamination, a common type of DNA damage, with single-molecule resolution. We profiled 134 samples from diverse tissues, including from individuals with cancer predisposition syndromes. These samples revealed single-strand mismatch and damage signatures. Since double-strand DNA mutations are only the endpoint of the mutation process, our approach enables new studies of how mutations arise in a variety of contexts, especially in cancer and aging.The data available via dbGaP includes raw HiDEF-seq sequencing files (Pacific Biosciences subreads in BAM format), raw NanoSeq sequencing files (Illumina FASTQ format), and raw germline sequencing files (Illumina FASTQ format).The HiDEF-seq main publication contains a supplementary table with a list of accession IDs for each sample's files.

  Study phs003604

• Tumor Profiler Melanoma Study

  The Tumor Profiler Study is an observational trial combining a prospective diagnostic approach to assess the relevance of in-depth tumor profiling to support clinical decision-making with an exploratory approach to improve the biological understanding of the disease. Technologies used are digital pathology, targeted NGS, single-cell RNA, single-cell DNA, bulk RNA, bulk proteotyping, single-cell CyTOF, imaging mass cytometry, pharmacoscopy, 4i Drug Response Profiling, and cell-free DNA. These technologies were applied to 240 tumor samples collected over 3 years across three cancer indications: metastatic melanoma, metastatic epithelial ovarian cancer, and acute myeloid leukemia (AML). Here, we publish the scRNA, scDNA, and bkRNA data of the melanoma cohort.

  Study EGAS50000000599

• RNA sequencing of follicular T cell lymphoma

  Study EGAS00001004646

• Indonesian RNA-seq data

  Transcription data were collected to study patterns of functional variation across the broad geography of Indonesia. The region has extremely diverse populations, with very different demographic histories and multiple genetic ancestries. This dataset reports high-throughput RNA-sequencing data for individuals from three islands spanning this geographical region: Mentawai, Sumba and West Papua.

  Study EGAS00001003671

• Proteogenomic analysis reveals RNA as a source for tumor-agnostic neoantigen identification (H021)

  Systemic pan-tumor analyses may reveal the significance of common features implicated in cancer immunogenicity and patient survival. Here, we provide a comprehensive multi-omics data set for 32 patients across 25 tumor types for proteogenomic-based discovery of neoantigens. By using an optimized computational approach, we discover a large number of tumor-specific and tumor-associated antigens. To create a pipeline for the identification of neoantigens in our cohort, we combine DNA and RNA sequencing with MS-based immunopeptidomics of tumor specimens, followed by the assessment of their immunogenicity and an in-depth validation process. We detect a broad variety of non-canonical HLA-binding peptides in the majority of patients demonstrating partially immunogenicity. Our validation process allows for the selection of 32 potential neoantigen candidates. The majority of neoantigen candidates originates from variants identified in the RNA data set, illustrating the relevance of RNA as a still understudied source of cancer antigens. This study underlines the importance of RNA-centered variant detection for the identification of shared biomarkers and potentially relevant neoantigen candidates.

  Study EGAS00001006706

• Comprehensive Genomic Characterization of Acral Melanoma

  In this study, we performed paired tumor/normal long insert whole genome and exome sequencing and tumor RNA sequencing on primary or metastatic acral melanoma tumors collected from 34 patients. Patients were enrolled from either Vanderbilt University or the Memorial Sloan-Kettering Cancer Center. We report an integrated analysis of DNA and RNA sequencing data to describe genomic and transcriptomic characteristics of acral melanoma.

  Study phs001036

• COVID_Methyl_scRNA

  DAC for the study of whole-genome enzymatic DNA methylation sequencing and single-cell RNA sequencing of nasal cells from COVID-19 patients. Nasal swabs were collected from COVID-19 patients during the acute phase of infection as well as 3 and 12-months post-infection. Cells isolated from nasal swabs were subjected to whole-genome enzymatic DNA methylation sequencing (n=33) and scRNA-seq (n=24). For n=12 former COVID-19 pateints, follow-up samples were collected at 3 and 12 months post-infection and subjected to scRNA-seq.

  Dac EGAC50000000197

• ZFHX4 is necessary for dopaminergic neuron differentiation and controls cell cycle by regulating LIN28A

  ZFHX4 as a transcription factor specifically induced during the in vitro differentiation of iPSC-derived mDANs. Depletion of ZFHX4 during neuronal differentiation led to a significant reduction in the number of mDANs while its overexpression did not lead to any changes in mDAN count. Identification of ZFHX4 target genes using CUT&Tag profiling and RNA-seq upon ZFHX4 knock-down (KD) revealed its involvement in cell cycle regulation during mDAN differentiation

  Dataset EGAD50000001605

• Stromal and dendritic cells from lymph nodes: single-cell RNA-seq

  Although cross-species transcriptional analysis has been generated for DCs, transcriptomic conservation between mouse and human FRCs at single-cell resolution has been unclear. To test whether GREM1+ FRCs might also play a role in DC homeostasis in humans, we performed scRNA-seq of CD45–PDPN+ stromal cells, as well as CD45+CD11c+ immune cells from healthy human LNs of three human donors. Data was generated using the 10x platform.

  Dataset EGAD00001008731

• Monosomy 7 delineates a primitive acute myeloid leukemia with adverse prognosis and responsiveness to epigenetic therapy

  The dataset comprises 27 single-cell multiome (ATAC + GEX) datasets generated from 13 patients with AML, collected across different stages of disease progression. In addition, matched long-read sequencing data from 5 samples were used to enable longitudinal analyses throughout the manuscript. Finally, bulk RNA-seq and ATAC-seq datasets from the cell line used in this study are also included.

  Dataset EGAD50000002359

• FOXM1 is a biomarker of resistance to PI3Kα inhibition in ER+ breast cancer that is detectable using metabolic imaging (RNA-seq data)

  PIK3CA, encoding the PI3Kα isoform, is the most frequently mutated oncogene in estrogen receptor-positive breast cancer. Isoform-selective PI3K inhibitors are used clinically but intrinsic and acquired resistance limits their utility. Improved selection of patients that will benefit from these drugs requires novel predictive biomarkers. We show here that persistent FOXM1 expression following drug treatment is a biomarker of resistance to PI3Kα inhibition in ER+ breast cancer. Since the transcription factor drives expression of lactate dehydrogenase (LDH) but not hexokinase 2 (HK-II), changes in FOXM1 expression can be detected using magnetic resonance imaging of LDH-catalyzed hyperpolarized 13C label exchange between pyruvate and lactate but not by PET measurements of HK-II-mediated trapping of the glucose analog 2-deoxy-2-[18F]fluorodeoxyglucose.

  Study EGAS00001004452