12004 results for "cancer rna-seq"

in 16.69 milliseconds.

• The genomic landscape of follicular and diffuse large B-cell lymphoma

  As part of the ICGC, the ICGC MMML-Seq project performed whole genome sequencing and RNA sequencing of follicular and diffuse large B-cell lymphoma. Follicular and diffuse large B-cell lymphomas are the most common B-cell lymphomas in adulthood. Analyses were performed in concordance with the guidelines of the ICGC. The results define the genomic landscape of structural variants, somatic single nucleotide variants and mutational signatures in these lymphomas

  Study EGAS00001002199

• GINS3 fibroblast RNAseq

  The eukaryotic CDC45/MCM2-7/GINS (CMG) DNA helicase unwinds the DNA double helix during DNA replication. We report the identification of individuals presenting with a Meier-Gorlin syndrome (MGS) like phenotype, secondary to hypomorphic variants in the GINS3 gene.  To verify whether the GINS3 variant affected the transcriptome, RNA-seq was performed from 3 fibroblast cultures derived from a patient with compound heterozygous GINS3 variants, and 1 replicate of fibroblasts derived from each of the two parents.

  Study EGAS00001006038

• Influence of culture media on airway differentiation at the Air-Liquid Interface

  Single-cell dataset of human airways after in vitro regeneration at the Air-Liquid Interface. Samples from 2 donors were used for the establishment of Human Bronchial Epithelial Cell cultures (HBECs) and were analyzed during proliferation, at the onset of differentiation (ALI0) and after full differentiation (ALI28), in 4 distinct culture media. Single-cell RNAseq was performed with 10x Genomics 3’ v2 RNA-seq using hashtag antibodies for multiplexing, and sequenced on a NextSeq 500. Samples from 3 additional donors were used for the establishment of Human Nasal Epithelial Cell cultures (HNECs) and were analyzed during proliferation in three distinct culture media. Single-cell RNAseq was performed with 10x Genomics 3’ v3 RNA-seq without multiplexing, and sequenced on a NextSeq 2000.

  Dataset EGAD00001011362

• RNA-seq of iPSC-derived oligodendrocytes of individuals with and without t(1;11) translocation

  This dataset contains high-throughput RNA-sequencing of 14 samples, each sample comprising oligodendrocytes derived from human induced pluripotent stem cells, from individuals with and without a balanced t(1;11) translocation which substantially increases risk of major mental illness. 5 samples derive from 2 control individuals, and 9 samples from 3 individuals carrying the translocation. Libraries were prepared from each total-RNA sample using the TruSeq Stranded Total RNA with Ribo-Zero kit. Libraries were then sequenced using the NextSeq 500/550 High-Output v2 (150 cycle) Kit on the NextSeq 550 platform. Raw paired-end sequencing data is stored in two FASTQ files per sample.

  Dataset EGAD00001006341

• Single-cell RNA-sequencing reveals that glioblastoma recapitulates a normal neurodevetlopmental hierarchy

  We discovered a conserved neural tri- lineage cancer hierarchy centered around glial progenitor-like cells. We also found that this progenitor population contains the majority of the cancer’s cycling cells, and, using RNA velocity, is often the originator of the other cell types. Finally, we show that this hierarchal map can be used to identify therapeutic targets specific to progenitor cancer stem cells. Our analyses show that normal brain development reconciles glioblastoma development, suggests a possible origin for glioblastoma hierarchy, and helps to identify cancer stem cell-specific targets.

  Study EGAS00001004422

• FASTQ files of the small RNA-Seq dataset from the POPS cohort

  Placental biopsies were collected within 30 minutes of birth and flash frozen in RNAlater(ThermoFisher). For each biopsy,total placental RNA was extracted from approximately 5 mg of tissue using the “mirVana miRNA Isolation Kit” (Ambion) followed by DNase treatment (“DNA-free DNA Removal Kit”, Ambion). RNA quality was assessed with the Agilent Bioanalyzer and all the samples with RIN values ≥ 7.0 were used in the downstream experiments. Total RNA-libraries were prepared from 300-500ng of total placental RNA with the “TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human/Mouse/Rat”(Illumina). Small RNA-libraries were prepared from 150ng of total placental RNA with the “NEBNext Multiplex Small RNA Library Prep Kit for Illumina”(New England Biolabs)and concentrated using the “QIAquick PCR purification kit”(Qiagen). Paired libraries were combined and size selected using the Pippin Prep and 3% Agarose Gel Cassette with marker F (Sage Science),pooled and sequenced (single-end, 50bp) using a Single End V4 cluster kit and HiSeq4000 instrument.

  Dataset EGAD00001004860

• Perturb-seq dataset

  We performed a systematic, genome-wide investigation of enhancer regions in colorectal cancer (CRC). We identified 12,117 putative enhancer regions using H3K27ac and H3Kme1 ChIP-seq and ATAC-seq. We performed scRNA-seq in HT29 and SW480 (MSS CRC cell lines) using the Parse Biosciences WT-mega kit with CRISPRi/dCas9 inhibition of these regions (Perturb-seq). The Parse split-pipe pipeline was used to demultiplex the raw fastq files into the processed files (mtx files for genes and gRNA) for each cell line.

  Dataset EGAD50000000375

• RNA sequencing of follicular T cell lymphoma

  Study EGAS00001004646

• BBMRI – BIOS – Freeze 2 – RNA-seq Counts

  Read counts determined using HTSeq-count for the BBMRI BIOS Freeze 2 RNAseq data

  Dataset EGAD00010001420

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• HiDEF-seq Single-Molecule Sequencing of Single-Strand Mismatches and Damage

  Our study sought to resolve, with single-molecule resolution, the mismatches and damage events that precede DNA mutations. Using a novel single-molecule, long-read sequencing method (HiDEF-seq) we detected base substitutions when present in either one or both DNA strands. We compared the fidelity for dsDNA mutations to that of the same samples profiled by NanoSeq duplex sequencing. We also detected cytosine deamination, a common type of DNA damage, with single-molecule resolution. We profiled 134 samples from diverse tissues, including from individuals with cancer predisposition syndromes. These samples revealed single-strand mismatch and damage signatures. Since double-strand DNA mutations are only the endpoint of the mutation process, our approach enables new studies of how mutations arise in a variety of contexts, especially in cancer and aging.The data available via dbGaP includes raw HiDEF-seq sequencing files (Pacific Biosciences subreads in BAM format), raw NanoSeq sequencing files (Illumina FASTQ format), and raw germline sequencing files (Illumina FASTQ format).The HiDEF-seq main publication contains a supplementary table with a list of accession IDs for each sample's files.

  Study phs003604

• Targeted gene fusion sequencing (Fus-seq) in mesothelioma

  This is a small pilot data set to test the feasibility of cDNA exomes across 1200 cancer cell line panel. cDNA exomes or Fus-seq is further explained in this studies Abstract.

  Dataset EGAD00001000361

• LEF1 knockdown effects on human T cell transcriptome and chromatin accessibility profiles.

  LEF1 (Lymphoid Enhancer-Binding Factor 1) is a key transcription factor in T cell development and function, and its dysregulation has been implicated in various immune-related disorders. This study aimed to comprehensively characterize the transcriptional and epigenetic changes induced by LEF1 knockdown in human T cells. CD3+ T cells isolated from three healthy donors were transfected with either LEF1-specific siRNA or control siRNA, followed by activation with CD3/CD28 Dynabeads and culture in IL-2-containing media. Cells were harvested at 24, 48 and 72 hours post-transfection for multi-omics analysis including bulk RNA-seq, bulk ATAC-seq, single-cell CITE-seq (For CITE-seq, 48 and 72 hours only). This dataset provides insights into LEF1-dependent gene regulatory networks and chromatin accessibility patterns in activated human T cells, contributing to our understanding of T cell biology and potential therapeutic targets. This dataset is part of a comprehensive study investigating functional roles of risk polymorphisms in autoimmune diseases, particularly focusing on the rs58107865 variant at the LEF1 locus.

  Study JGAS000818

• Tumor Profiler Melanoma Study

  The Tumor Profiler Study is an observational trial combining a prospective diagnostic approach to assess the relevance of in-depth tumor profiling to support clinical decision-making with an exploratory approach to improve the biological understanding of the disease. Technologies used are digital pathology, targeted NGS, single-cell RNA, single-cell DNA, bulk RNA, bulk proteotyping, single-cell CyTOF, imaging mass cytometry, pharmacoscopy, 4i Drug Response Profiling, and cell-free DNA. These technologies were applied to 240 tumor samples collected over 3 years across three cancer indications: metastatic melanoma, metastatic epithelial ovarian cancer, and acute myeloid leukemia (AML). Here, we publish the scRNA, scDNA, and bkRNA data of the melanoma cohort.

  Study EGAS50000000599

• Pooled scRNA-seq of iPSC-derived neural stem cells from ADHD and control individuals

  This dataset comprises paired-end FASTQ files from single-cell RNA sequencing (scRNA-seq) of neural stem cells (NSCs) derived from induced pluripotent stem cells (iPSCs). The iPSCs were reprogrammed from somatic cells (keratinocytes, PBMCs, or lymphoblastoid cell lines) collected from individuals diagnosed with attention-deficit hyperactivity disorder (ADHD) and age-matched healthy controls (ages 6–18 years). Reprogramming was carried out using the non-integrative Sendai virus system (CytoTune-iPS 2.0, Thermo Fisher Scientific), introducing OCT3/4, SOX2, KLF4, and cMYC. iPSCs were cultured in Essential 8 medium on vitronectin and underwent rigorous quality control including immunocytochemistry, qRT-PCR, mycoplasma testing, and SNP genotyping (Illumina Global Screening Array). NSCs were generated using a standardized neural induction protocol and validated via qRT-PCR and immunostaining for markers including PAX6, SOX2, NESTIN, TUJ1, and FOXG1. Two independent scRNA-seq multiplexed experiments were performed: Experiment 1 (ADHD: n = 7; Control: n = 6) and Experiment 2 (ADHD: n = 9; Control: n = 7). Samples were pooled and demultiplexed using the Ensemblex algorithm, incorporating prior genotype data. After quality control filtering (>500 unique RNA molecules per cell), 30,433 single-cell transcriptomes were retained. Differential gene expression analysis was conducted to identify transcriptional signatures associated with ADHD compared to controls.

  Study EGAS00001008169

• Neutrophils and emergency granulopoiesis drive immune suppression and an extreme response endotype during sepsis

  This dataset contains raw sequencing files associated with the paper "Neutrophils and emergency granulopoiesis drive immune suppression and an extreme response endotype during sepsis" (https://doi.org/10.1038/s41590-023-01490-5). It is composed of two experiments, which are as follows: 1. Single-cell profiling of whole blood leukocytes: This experiment comprises sequencing files generated using the BD Rhapsody single-cell multi-omics profiling (RNA + protein) platform. This platform was used to profile the whole blood leukocyte population in a cohort of sepsis patients, cardiac surgery controls and healthy controls. There are 48 samples and four files per sample: two paired-end FASTQ files (R1 and R2) corresponding to the RNA-seq library, and two paired-end FASTQ files (R1 and R2) corresponding to the protein profiling (ADT-based AbSeq) library. 2. Single-cell profiling of circulating HSPCs: This experiment comprises sequencing files generated using the 10X single-cell multi-omics (RNA-seq + ATAC-seq) profiling platform. This platform was used to profile circulating HSPCs in a cohort of sepsis patients and healthy controls. There are 5 samples (or plexes), each of which consists of a pool of individuals for whom cells were multiplexed and sequenced as a single sample. There are four files per sample: two paired-end FASTQ files (R1 and R2) corresponding to the RNA-seq library, and two paired-end FASTQ files (R1 and R2) corresponding to the ATAC-seq library. Because these samples consists of multiplexed pools, index files are also provided. These can be used for sample deconvolution using the Cell Ranger pipeline. NOTE: Due to EGA's constrains in the number of files permitted per sample, index files (I1 and I2) for the HSPC data set are provided as a separate experiment named "FASTQ index files (I1 and I2) for deconvolution of 10X single-cell multiomics libraries".

  Dataset EGAD00001010927

• Comprehensive Genomic Characterization of Acral Melanoma

  In this study, we performed paired tumor/normal long insert whole genome and exome sequencing and tumor RNA sequencing on primary or metastatic acral melanoma tumors collected from 34 patients. Patients were enrolled from either Vanderbilt University or the Memorial Sloan-Kettering Cancer Center. We report an integrated analysis of DNA and RNA sequencing data to describe genomic and transcriptomic characteristics of acral melanoma.

  Study phs001036