12304 results for "cancer rna-seq"

in 27.37 milliseconds.

• HiDEF-seq Single-Molecule Sequencing of Single-Strand Mismatches and Damage

  Our study sought to resolve, with single-molecule resolution, the mismatches and damage events that precede DNA mutations. Using a novel single-molecule, long-read sequencing method (HiDEF-seq) we detected base substitutions when present in either one or both DNA strands. We compared the fidelity for dsDNA mutations to that of the same samples profiled by NanoSeq duplex sequencing. We also detected cytosine deamination, a common type of DNA damage, with single-molecule resolution. We profiled 134 samples from diverse tissues, including from individuals with cancer predisposition syndromes. These samples revealed single-strand mismatch and damage signatures. Since double-strand DNA mutations are only the endpoint of the mutation process, our approach enables new studies of how mutations arise in a variety of contexts, especially in cancer and aging.The data available via dbGaP includes raw HiDEF-seq sequencing files (Pacific Biosciences subreads in BAM format), raw NanoSeq sequencing files (Illumina FASTQ format), and raw germline sequencing files (Illumina FASTQ format).The HiDEF-seq main publication contains a supplementary table with a list of accession IDs for each sample's files.

  Study phs003604

• Evaluation of Local Response of Prostate Cancer to Irradiation Using Multiparametric MRI and MR-Guided Biopsies

  The purpose of this study was to determine the rate of local recurrence in patients with intermediate and high risk prostate cancer treated with radiotherapy. In this study, multiparametric MRI was first performed, and biopsy tissue was acquired from cancerous regions detected on MRI. Blood samples were also taken. DNA and RNA were extracted from tissue taken at baseline. DNA was used for whole exome sequencing (WES). RNA was used for gene expression microarray. Each patient then received radiation therapy with androgen deprivation therapy.

  Study phs001821

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• Gene Expression Signatures Characterized by Longitudinal Stability and Inter-Individual Variability Delineate Baseline Phenotypic Groups with Distinct Responses to Immune Stimulation

  RNA sequencing (RNAseq) of peripheral blood lymphocytes was used to develop a means to assess immune function in a way that can be used in discovery science and applied to patients individually in clinical settings. The premise is that profiles of RNA present in immune cells is reflective of the combined influence of genetic and environmental variation on immune potential of individuals and that this potential can be tapped to understand human immunity in a variety of biological contexts. CD4+ cells were isolated from fresh whole blood via positive magnetic bead selection and cell lysates were prepared using Qiazol (QIAGEN) and stored at -80ºC for 3 to 8 months. RNA was extracted in batches for cDNA library preparation and RNA-Seq. For this study, we developed standard operating procedures for handling human blood samples and determined: a) the best way to enrich for CD4+ T cells from whole blood and yield high quality RNA, b) the sensitivity of this RNA profiling strategy, and c) the reproducibility of generated immune profiles from healthy subjects. We then developed bioinformatics processes to establish immune response signatures and immune response phenotypes within cohorts of individuals.

  Study phs001512

• Genome and transcriptome sequencing of cancer of unknown primary tumours

  Genome and transcriptome sequencing of cancer of unknown primary tumours was used to determine yield of clinical biomarkers for a molecular guided trial or for resolving cancer type of origin. This study includes profiling of germline DNA and tumour DNA by whole genome sequencing of tissue and cfDNA biopsies, as well as targeted genome sequencing using two panels, including Comprehensive cancer panel (CCP) and TruSight Oncology 500 (TSO500). This study also includes profiling of tumour RNA by whole transcriptome sequencing.

  Study EGAS50000000452

• Experimental PfSPZ Vaccine in Adults Without Malaria

  The study was performed to evaluate whole-blood transcriptomic profiles via RNA-seq before, during, and after immunization with the PfSPZ Vaccine in malaria-naïve, healthy adults enrolled in VRC 312 (NCT01441167). VRC 312 was the second study of the PfSPZ Vaccine and the first study to evaluate intravenous (IV) administration of this vaccine. The study was an open-label evaluation of the safety, tolerability, immunogenicity, and protective efficacy of the vaccine at successively higher administered by the IV route. The highest dosages were evaluated for protection against a malaria challenge after 4 to 6 vaccinations. The primary objectives of the study were related to the safety and tolerability of the vaccine at the 4 different dosage levels when administered IV; the secondary objectives were related to PfSPZ vaccine-mediated protection against Plasmodium falciparum (Pf) challenge at the 3 higher dosage levels, and the exploratory objectives were related to the immunogenicity of the PfSPZ Vaccine and defining an immune correlate of protection. To further determine potential molecular correlates of immunogenicity and/or protection, RNA-seq was performed on whole blood collected from subjects in all dose groups at time points before, during, and after immunization.

  Study phs002422

• Cholesterol and Pharmacogenetics (CAP) Study

  The Cholesterol and Pharmacogenetics Study was a 6-week open label, non-randomized study of 40mg/day simvastatin treatment in 335 black and 609 white (944 total) men and women. Plasma lipids and lipoproteins were measured on two occasions prior to treatment and at 4 and 6 weeks of treatment. The study was designed to test for genetic associations with baseline measurements and changes in response to simvastatin treatment. Whole genome genotyping was performed on 592 white CAP study participants in two stages. In Stage 1, 304 were genotyped for 314,621 SNPs to tag for common genomic variation. In Stage 2, 290 participants were genotyped, including 280 who were genotyped for 620,901 SNPs. Two samples were excluded due to gender discrepancies. More recently, CAP self-reported black participants were genotyped on Illumina Omni2.5Exome chips. PolyA-selected strand-specific RNA-seq libraries were generated in several batches from lymphoblastoid cell lines (LCLs) derived from 268 white and 165 black CAP participants. The LCLs were exposed to sham buffer (control) or 2 uM activated simvastatin for 24 hours, producing a total of 866 100/101 bp paired end RNA-seq libraries sequenced on Illumina HiSeq 2000 machines.

  Study phs000481

• HTAN Pilot Project: Single-Cell Transcriptomics Toolbox for Fresh and Frozen Human Tumors (Lung, Breast, Ovarian, Melanoma, Neuroblastoma, Sarcoma, Glioblastoma, Glioma, and Leukemia)

  Single cell transcriptomics is a powerful tool to map the complex tumor microenvironment, providing unprecedented resolution into cell types, cell states, cell interactions, and tumor heterogeneity. Depending on their tissue site and whether processing begins from a fresh or frozen sample, different tumors require different optimizations in order to obtain high quality single cell transcriptomic data. In this study, we profiled a range of tumor types, varying in cell-of-origin, solid and non-solid forms, patient ages, and transitions. The tumors also further varied in their tissue site and in their sample collection method. To enable profiling of such diverse samples, we developed a systematic toolbox for single cell RNA-Seq and single nucleus RNA-Seq of fresh and frozen clinical tumor samples. We validated this toolbox for 216,490 cells and nuclei extracted from 39 samples across 23 tumors (some tumors were split into multiple samples). The 23 tumors represented eight unique tumor types. This toolbox comprises both experimental and computational protocols as well as guidelines for comparing and selecting protocols for the biological problem of interest.

  Study phs001983

• Differential Presence of Exons in Cell-Free DNA Reveals Different Patterns in Colorectal Cancer Between Metastatic and Non-Metastatic Patients

  Tumor genotyping during disease follow-up is gaining an increasing interest for monitoring and clinical management in colorectal cancer (CRC). Growing evidences suggest that single biopsies are inefficient for molecular profiling, due to clonal evolution and intratumoral heterogeneity of primary tumors and/or metastasis. Circulating free DNA (cfDNA) has emerged as an alternative source of genetic material that seems to be representative of the continuously changing tumor molecular features. Thus, the so-called 'liquid biopsy' also offers the additional advantages of accessibility and non-invasiveness for the patient. Novel strategies based on next-generation sequencing (NGS) of cfDNA are being currently developed, with most studies focusing on targeted deep sequencing panels of potential clinically actionable genes. Here we describe an alternative approach, consisting of exome-sequencing in cfDNA at a relatively shallower depth to provide a more general overview of the circulating genome. In this study, two groups of colorectal cancer patients, with either disseminated (M) or localized disease (N), were compared using whole-exome sequencing and a RNA-seq bioinformatics analysis pipeline. Thus, a set of 379 exons present at different levels in cfDNA from both groups were identified, giving rise to a completely new concept in this field, termed as 'Differential Presence of Exons'. Differentially present exons (DPEs) were subsequently used for M and N patients clustering and classification, allowing for the design of a predictive algorithm with encouraging preliminary results in a small subset of patients that could not be initially classified attending to the selection criteria (U group, unassignable).

  Study EGAS00001002687

• Molecular Characterization for Nasopharyngeal Carcinoma (NPC)

  Total RNA was isolated from 50 formalin-fixed paraffin-embedded nasopharyngeal cancer (NPC) specimens using the RecoverAll Total Nucleic Acid Isolation kit (Ambion). Tumor RNA libraries were prepared with 200ng RNA using the Illumina TruSeq Stranded Total RNA kit with Ribo-Zero Gold, and sequenced with >80 million 100 bp paired-end reads.

  Dataset EGAD00001009047

• COVID_Methyl_scRNA

  DAC for the study of whole-genome enzymatic DNA methylation sequencing and single-cell RNA sequencing of nasal cells from COVID-19 patients. Nasal swabs were collected from COVID-19 patients during the acute phase of infection as well as 3 and 12-months post-infection. Cells isolated from nasal swabs were subjected to whole-genome enzymatic DNA methylation sequencing (n=33) and scRNA-seq (n=24). For n=12 former COVID-19 pateints, follow-up samples were collected at 3 and 12 months post-infection and subjected to scRNA-seq.

  Dac EGAC50000000197

• Monosomy 7 delineates a primitive acute myeloid leukemia with adverse prognosis and responsiveness to epigenetic therapy

  The dataset comprises 27 single-cell multiome (ATAC + GEX) datasets generated from 13 patients with AML, collected across different stages of disease progression. In addition, matched long-read sequencing data from 5 samples were used to enable longitudinal analyses throughout the manuscript. Finally, bulk RNA-seq and ATAC-seq datasets from the cell line used in this study are also included.

  Dataset EGAD50000002359

• ZFHX4 is necessary for dopaminergic neuron differentiation and controls cell cycle by regulating LIN28A

  ZFHX4 as a transcription factor specifically induced during the in vitro differentiation of iPSC-derived mDANs. Depletion of ZFHX4 during neuronal differentiation led to a significant reduction in the number of mDANs while its overexpression did not lead to any changes in mDAN count. Identification of ZFHX4 target genes using CUT&Tag profiling and RNA-seq upon ZFHX4 knock-down (KD) revealed its involvement in cell cycle regulation during mDAN differentiation

  Dataset EGAD50000001605

• Stromal and dendritic cells from lymph nodes: single-cell RNA-seq

  Although cross-species transcriptional analysis has been generated for DCs, transcriptomic conservation between mouse and human FRCs at single-cell resolution has been unclear. To test whether GREM1+ FRCs might also play a role in DC homeostasis in humans, we performed scRNA-seq of CD45–PDPN+ stromal cells, as well as CD45+CD11c+ immune cells from healthy human LNs of three human donors. Data was generated using the 10x platform.

  Dataset EGAD00001008731

• Small RNA sequencing of untreated and castration resistant prostate cancer

  Small RNA sequencing of 28 untreated prostate cancers, 12 castration resistant prostate cancers, and 3 benign prostatic hyperplasias.

  Dataset EGAD00001000611

• cfDNA methylation dataset for colon cancer

  Enzymatic conversion-based methylation sequencing data (EM-seq) for colon cancer used in the MESA study

  Dataset EGAD50000000075

• GM adipose tissue study

  The Greek Metabolic (GM) adipose study was carried out in 106 individuals living in Greece and consists of genotyping data (chip), RNA-Seq and ATAC-Seq (for a subset of individuals) data from paired biopsies of Subcutaneous and Visceral adipose tissue. eQTL mapping was performed to study gene regulation and findings compared to those from adipose tissue GTEX data. The focus of this project was to study an underexplored population living in different environmental conditions in order to reveal novel regulatory effects for genes that shape complex traits and disease risk. Our results highlight the utility of modest-sized studies in adding to our understanding of the molecular basis of complex traits and to the identification of mechanisms that drive disease in specific tissues.

  Study EGAS00001007126

• Analytical study of protein function and RNA expression involved in predicting treatment efficacy and adverse event development in lung cancer radiotherapy.

  The purpose of this study is to elucidate the functions of DNA repair proteins and RNA expression that are involved in the therapeutic efficacy and adverse events of radiotherapy for lung cancer at our hospital. In particular, this is an exploratory study to identify proteins and RNAs involved in the expression of proteins that are likely to be involved in the prediction of radiotherapy response and adverse events.

  Study JGAS000545

• Cell Type-Specific and Disease-Associated eQTL in the Human Lung

  This study was conducted to investigate the genetic control of gene expression in a cell-type and context-specific manner in the human lung. We performed single-cell RNA-sequencing (scRNA-seq) of lung tissue from 66 Interstitial Lung Disease (ILD) cases and 48 unaffected donors. Employing a pseudo-bulk approach, we mapped expression quantitative trait loci (eQTL) across 38 cell types. The scRNA-seq data presented here include previously published (PMID 34262047) and unpublished samples. ILD tissue samples were obtained from lungs removed at the time of lung transplantation at either Vanderbilt University Medical Center (VUMC) or the Norton Thoracic Institute (NTI). Control tissue samples were obtained from lungs declined for organ donation either at the Donor Network of Arizona (DNA) or VUMC. The self-reported ethnicities of donors were 66.7% European, 9.6% African American, 17.5% not available (N/A), and 6.1% other. The smoking history includes 46.5% ever smoker, 29.8% never smoker, 23.7% N/A. For genotyping, flash-frozen tissue in DNA/RNA shield was homogenized via a bullet blender. Genomic DNA was extracted using Zymo Quick DNA/RNA microprep plus kit. Library preparation and low-pass Whole Genome Sequencing (WGS) were carried out at TGen or by Gencove Inc. At TGen, libraries were prepared using PCR-free Watchmaker kits (Watchmaker Genomics) with 200 ng input. Genomes were sequenced on NovaSeq at low coverage (typically 0.4–1x). The resulting sequence data were processed and imputed using Gencove's imputation platform.

  Study phs003521

• Risk Factors for Asymptomatic Diverticulosis

  Data for this analysis came from a prospective study of colonic diverticulosis at the University of North Carolina Hospital in Chapel Hill, North Carolina (NIH R01DK094738). This is a case-control genetic and transcriptomic study to identify the genetic and cellular determinants underlying colonic diverticulosis and the relationship with other gastrointestinal disorders. The study inclusion and exclusion are described below. DNA and RNA sequencing were performed on colonic tissue from 404 patients with (N=172) and without (N=232) diverticulosis. We assessed variation in the transcriptome associated with diverticulosis and integrated this variation with human intestine single-cell RNA-seq data. We integrated our expression quantitative trait loci with GWAS using Mendelian Randomization. A polygenic risk score analysis examined associations between severity of diverticulosis and other gastrointestinal disorders. We identified 38 genes with differential expression and 17 genes with varied transcript usage linked to diverticulosis. Our results suggest tissue remodeling as a primary mechanism for diverticula formation. The presence of diverticulosis was linked to stromal and epithelial cells in the colon including endothelial cells, myofibroblasts, fibroblasts, goblet, tuft, enterocytes, neurons, and glia. MR highlighted five genes including CCN3, CRISPLD2, ENTPD7, PHGR1, and TNFSF13. In diverticulosis cases, ENTPD7 upregulation was confirmed. A greater burden of diverticula was positively correlated with genetic predisposition to diverticulitis. The data related to the study including total RNA-Seq, SNP array and imputed genotypes will be available through dbGaP.

  Study phs003556