15120 results for "cancer studies using rna-seq"

in 23.98 milliseconds.

• Liquid-based genomic profiling in high-risk localized prostate cancer.

  In this study, we evaluated the feasibility and performance of tissue and liquid-based genomic profiling in patients with high-risk localized prostate cancer. Genomic DNA from 12 FFPE tissue samples and cell-free DNA from 27 plasma samples were analyzed using Illumina TruSight Oncology (TSO) 500 panels.

  Study EGAS50000001712

• RNA sequencing data of 66 matched primary and recurrent high grade serous ovarian cancer

  Dac EGAC00001000741

• Targeted RNA sequencing of breast cancer GWAS loci

  Dataset EGAD00001004498

• Dataset for colorectal_cancer-RNA

  Rare cancer sequencing data of 97 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008855

• Dataset for Direct Detection of Early-Stage Cancers using Circulating Tumor DNA

  The dataset for Direct Detection of Early-Stage Cancers using Circulating Tumor DNA includes 602 bam files from next-generation sequencing on the Illumina HiSeq2500 or MiSeq. The samples analyzed include cancer cell lines as well as plasma and tissue specimens from healthy individuals and patients with cancer.

  Dataset EGAD00001003601

• APCIM_Nanostring_FAP

  Expression of immune related genes in 12 familial adenomatous polyposis patients. Expression assessed by analyzing whole blood-derived RNA samples using a Nanostring nCounter Immunology V2 panel (579 genes)

  Dataset EGAD00010002553

• Single Nuclei RNA sequencing batch 2

  This dataset includes the 2 extra normal samples adjacent to PTC tumors that were multiplexed and profiled using kits from different batches.

  Dataset EGAD00001011364

• WGS of high grade serous ovarian tumours and matched blood normals

  FASTQ reads for 81 matched tumour-normal WGS pairs for high grade serous ovarian cancer patients. Scottish HGSOC samples were collected via local Bioresource facilities at Edinburgh, Glasgow, Dundee and Aberdeen and stored in liquid Nitrogen until required. HGSOC patients were determined from pathology records and were included in the study where there was matched tumour and whole blood samples. Tumour samples were divided into two for DNA and RNA extraction and slivers of tissue were taken, fixed in formalin and embedded in paraffin wax (FFPE). Samples were only included if they were confirmed as HGSOC and there was greater than 40% tumour cellularity throughout the tumour, determined using H&E staining of the FFPE sections and pathology review. Somatic DNA was extracted from the tumour and germline DNA was extracted from whole blood. Somatic DNA was extracted using the Qiagen DNeasy Blood and tissue kit (cat no 69504). The tissue was initially homogenised using a Qiagen Bioruptor, followed by the manufacturers recommended protocol (including RNase digestion step). Germline DNA was extracted from 1-3ml whole blood using the Qiagen FlexiGene kit (cat no 51206) following the manufacturers recommended protocol. The resulting DNA underwent quality control as follows: firstly, A260 and A280nm were measured on a Denovix DS-11 Fx to qualitatively illustrate A260/280nm and A260/230nm ratios as surrogate measures of DNA purity. A260/280 had to be 1.8 or greater and A260/230 had to be 2.0 or greater. Then, DNA was quantified using LifeTechnologies Qubit dsDNA BR kit (cat no Q32850) and we required a minimum of 50ul at 25ng/ul for WGS. Thirdly, DNA was diluted to 25ng/ul and a representative sample was loaded onto a 0.8% TAE gel, ran at 100v for 60mins and then imaged using a BioRad ChemiDoc imaging system to visualise the DNA quality.

  Dataset EGAD00001009049

• WGS of high grade serous ovarian tumours and matched blood normals

  FASTQ reads for 34 matched tumour-normal WGS pairs for high grade serous ovarian cancer patients. Scottish HGSOC samples were collected via local Bioresource facilities at Edinburgh, Glasgow, Dundee and Aberdeen and stored in liquid Nitrogen until required. HGSOC patients were determined from pathology records and were included in the study where there was matched tumour and whole blood samples. Tumour samples were divided into two for DNA and RNA extraction and slivers of tissue were taken, fixed in formalin and embedded in paraffin wax (FFPE). Samples were only included if they were confirmed as HGSOC and there was greater than 40% tumour cellularity throughout the tumour, determined using H&sE staining of the FFPE sections and pathology review. Somatic DNA was extracted from the tumour and germline DNA was extracted from whole blood. Somatic DNA was extracted using the Qiagen DNeasy Blood and tissue kit (cat no 69504). The tissue was initially homogenised using a Qiagen Bioruptor, followed by the manufacturers recommended protocol (including RNase digestion step). Germline DNA was extracted from 1-3ml whole blood using the Qiagen FlexiGene kit (cat no 51206) following the manufacturers recommended protocol. The resulting DNA underwent quality control as follows: firstly, A260 and A280nm were measured on a Denovix DS-11 Fx to qualitatively illustrate A260/280nm and A260/230nm ratios as surrogate measures of DNA purity. A260/280 had to be 1.8 or greater and A260/230 had to be 2.0 or greater. Then, DNA was quantified using LifeTechnologies Qubit dsDNA BR kit (cat no Q32850) and we required a minimum of 50ul at 25ng/ul for WGS. Thirdly, DNA was diluted to 25ng/ul and a representative sample was loaded onto a 0.8% TAE gel, ran at 100v for 60mins and then imaged using a BioRad ChemiDoc imaging system to visualise the DNA quality.

  Dataset EGAD00001010135

• Somatic L1 retrotransposition mapping in high-grade serous ovarian carcinoma using LDI-PCR/Nanopore-sequencing

  Somatic L1 retrotransposition was mapped in high-grade serous carcinoma (HGSC) tumors using LDI-PCR/Nanopore-seq method. This method identifies somatic L1 insertions originating from two active L1 loci at chr22q12.1 and chrXp22.2. Multiple tumors from the same patient were utilised to understand L1-mediated intrapatient heterogeneity. Long-read data generated by LDI-Nanopore sequencing was aligned to the reference genome (GRCh38).

  Dataset EGAD50000001707

• DNA-seq BAM files from 16 patients affected by acute intermittent porphyria

  Paired-end BAM files from 16 patients affected by acute intermittent porphyria. Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). FASTQ files were processed at the CNAG (Barcelona) using the GEM short-read aligner on the human genome version hs37d5, producing a total of 16 BAM files.

  Dataset EGAD00001006951

• Comprehensive genomic characterization of early stage bladder cancer - nanopore sequencing

  For this project about non-muscle invasive bladder cancer (NMIBC), we analysed long read sequencing data from 4 patients using the Nanopore platform. The dataset is composed of 8 BAM files: 4 tumor samples and 4 paired blood samples.

  Study EGAS50000000510

• Development and Use of Network Infrastructure for High-Throughput GWA Studies

  The "Development and Use of Network Infrastructure for High-Throughput GWA Studies" project is collaboration between Group Health Cooperative (GH), the University of Washington (UW), and the Fred Hutchinson Cancer Research Center (FHCRC). It is one of 5 sites participating in The Electronic Medical Records and Genomics (eMERGE) Network funded by the National Human Genome Research Institute (NHGRI) with additional funding from the National Institute of General Medical Sciences (NIGMS). The overall eMERGE project is designed to assess whether linking biorepositories of patients in healthcare delivery systems with electronic medical records (EMRs) is an efficient strategy for high-throughput genome wide association (GWA) studies and whether information can be pooled across sites. The primary phenotype in the Group Health/UW Aging and Dementia eMERGE study project is dementia. Phenotyped participants originated from four population-based sources. Seattle-area members of GH (a large integrated health care system in Washington State) consented and enrolled in 1) the University of Washington Alzheimer's Disease Patient Registry (ADPR) and 2) the Adult Changes in Thought (ACT) study, 3) Marshfield Clinic Personalized Medicine Research Project (PMRP), a population-based DNA, plasma and serum biobank of 20,000 adults, 4) Vanderbilt's BioVU, a de-identified DNA biobank. The ADPR (PI: Eric B. Larson; NIH/NIA U01 AG 006781) is a population-based registry of incident dementia cases designed to identify all new dementia cases within GH from 1987 to 1996. Potential dementia cases were identified through referrals from primary care physicians, mental health services, and neurologists, as well as review of CT scans, neurology, emergency room, geriatrician, and mental health clinic logs, and hospital discharge diagnoses. Medical history, physical, laboratory testing, and neuropsychological testing were performed on all consenting potential cases. These data were reviewed by a consensus conference including a neuropsychologist, study physicians, and an epidemiologist. After discussion of the case, dementia status is assigned using DSM-III-R criteria. Alzheimer's disease status was assigned using the National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer's Disease and Related Disorders Association (NINCDS-ADRDA) criteria. The study base of the ADPR population was stable with an attrition rate of less than 1%/year. The ACT study (PI: Eric B. Larson; NIH/NIA U01 AG 006781) is an ongoing community-based cohort study designed to determine the incidence of Alzheimer's Disease (AD), other types of dementia, and cognitive impairment and to determine risk factors for these conditions. The original cohort of 2,581 was enrolled in 1994-1996. An expansion cohort of 811 was enrolled in 2000-2002. Continuous enrollment to keep 2,000 persons enrolled and at-risk for dementia outcomes was begun in 2005. To date the study has accrued more than 4,000 participants. Dementia-free participants are enrolled in this cohort and evaluated every two years by study personnel with many evaluations including an assessment of cognitive functioning using the Cognitive Abilities Screening Instrument (CASI), which is an extended version of the Mini-Mental State Examination that has been widely used in epidemiological studies of the elderly. Persons with CASI scores lower than 86 or in whom interviewers suspect unusual cognitive decline are followed up with dementia diagnostic evaluations which include physical and neurological examinations and neuropsychological tests. Medical records are reviewed, and laboratory tests and neuroimaging are obtained if not available. The dementia diagnoses and dementia subtypes are determined during a consensus conference attended by the examining clinicians and other study physicians, a neuropsychologist, and research nurse. After discussion of the case, dementia status is assigned using DSM-IV criteria. Alzheimer's disease status was assigned using NINCDS-ADRDA criteria. Individuals diagnosed with dementia are seen again one year following diagnosis using the same procedures. Individuals not diagnosed with dementia are returned to the pool of at-risk individuals and are seen at their next routinely scheduled biennial visit. The ACT sub-sample is stable; for the original cohort, median enrollment in GH was 19 years prior to joining the ACT study, and 85% of the cohort has ≥ 10 years of GH enrollment. DNA for the ADPR participants were obtained through a companion study, Genetic Differences in Cases and Controls (PI: Walter Kukull; NIH/NIA R01 AG007584). DNA obtained through both studies were extracted from blood using Gentra Systems Puregene methods. DNA concentration is determined by UV optical density. All samples are checked for quality by OD 260/280 ratio. For long-term storage, samples are aliquoted and stored at -70°C. The Marshfield study, Personalized Medicine Research Project (PMRP), a population-based DNA, plasma and serum biobank of 20,000 adults. PMRP was started in 2002 as a 3 Phase project. Completed in April 2004, the objectives of Phase I were to build and develop a large population-based biobank with DNA, plasma and serum samples to facilitate genomics research. Phase 1 was also to educate, inform and consult with the Marshfield Epidemiologic Study Area population and communities concerning potential studies, create the DNA foundation of the personalized medicine database and build the bioinformatics tools to store securely and analyze genotypic and phenotypic data. Phase I tasks included operation of the ethics and security advisory board, scientific advisory board and community advisory group. More than 18,000 residents aged 18 and above from 19 different zip codes surrounding Marshfield, WI were invited to participate in Phase I. After providing written informed consent, participants completed brief questionnaires that included questions about demographics, some environmental exposures, family history of disease, and adverse drug reactions, as well as family members living in the area. Participants provided 50ml of blood from which DNA was extracted and plasma and serum samples were stored. The informed consent process allowed access to electronic medical records and included language about non-disclosure of personal research results. A tick-off box was included so that participants could either allow or decline subsequent recontact for future research studied. The objectives of Phase II are to create the phenotypic database, establish the scientific and administrative infrastructure to support genetic mapping of the DNA and the initial discovery projects and genotype a sufficient portion of the genetic material to support these discovery projects. The objectives of Phase III are to expand the discovery projects, complete the genotyping of the genetic database and expand physician/health care provider education and community consultation. The Vanderbilt BioVU model uses discarded blood leftover from clinical care and de-identified clinical information, both of which are tracked with a Research Unique Identifier that is permanently disconnected from the medical record number used to generate it. The Vanderbilt IRB determined that the project does not qualify as "human subject" research under §46.102(f)(1)(2). The program has been reviewed by OHRP twice (the latest immediately prior to launch), and the determination of the Vanderbilt IRB that the project is consistent with the 8/10/2004 guidance has been validated. The model includes a simple opt out mechanism developed for patients who do not wish to have their samples included. Planning (including community involvement, ethics and IRB discussions, focus groups, development of operating procedures and pilot studies to assess them) began in May 2004, and the resource commenced sample collection in February 2007 and as of May 2009 contains approximately 56,000 samples. The current resource will be available to all Vanderbilt investigators who sign a Data Use Agreement. The resource represents Vanderbilt's broad patient population and thus provides a potential resource for research in a range of common and rare diseases as well as drug response or medication safety. BioVU patient protection model: There has been extensive involvement by the ethics community and the IRB to put in place procedures to provide privacy protection. The overall protection plan is multifaceted and includes a combination of technology and policy: (1) creation of the SD described above; (2) return of only the specific clinical data items requested by investigators (rather than the complete de-identified chart); (3) submission of any specific proposed project to the IRB and to a separate protocol review committee, both of which must approve; (4) implementing a Data Use Agreement that permits only approved queries and data analyses, specifically prohibits attempts at re-identification (at the risk of institutional sanctions), and mandates redeposit of all genetic information generated in a research study back into a genomic database; and (5) tracking and auditing all use.

  Study phs000234

• Single Cell RNA-Sequencing in Adenoid Cystic Carcinoma

  This study of salivary adenoid cystic carcinoma aimed to profile individual malignant and stromal cells in treatment-naive head and neck adenoid cystic carcinoma, with or without metastatic cervical lymph nodes. Clinical and pathologic information was collected on all patients, in addition to a fresh biopsy sample from the primary tumor and/or metastatic lymph node at the time of initial surgery. A fresh biopsy sample from a matched local recurrence was also collected for a single unique patient. Biopsy specimens were processed for single cell RNA-seq. A total of ~1,700 single cells from seven participants were included in the final dataset.

  Study phs003070

• Onco-exaptation of an Endogenous Retroviral LTR Drives IRF5 Expression in Hodgkin Lymphoma

  The transcription factor interferon regulatory factor 5 (IRF5) is upregulated in Hodgkin lymphoma (HL) and a key regulator of the aberrant transcriptome characteristic of this disease. Here we show that IRF5 upregulation in HL is driven by transcriptional activation of a normally dormant endogenous retroviral LOR1a long terminal repeat (LTR) upstream of IRF5. Specifically, through screening of RNA-seq libraries, we detected LTR-IRF5 chimeric transcripts in multiple HL cell lines but not in normal B-cell controls. In HL, the LTR was in an open and hypomethylated epigenetic state and we further show the LTR is the site of transcriptional initiation. Among HL cell lines, usage of the LTR promoter strongly correlates with overall levels of IRF5 mRNA and protein, indicating that LTR transcriptional awakening is a major contributor to IRF5 upregulation in HL. Taken together, oncogenic IRF5 overexpression in HL is the result of a specific LTR transcriptional activation. We propose that such LTR derepression is a distinct mechanism of oncogene activation (“onco-exaptation”) and that such a mechanism warrants further investigation in molecular and cancer research.

  Study EGAS00001001205

• RNASeq profiles from Indian HFrEF Cohort

  The dataset contains whole transcriptomics profiling from a cohort of 49 HFrEF patients. The myocardium samples were collected from these patients during heart transplant of LVAD implantation procedure. The RNA samples were collected in RNAlater. Total transcriptome libraries were prepared using TruSeq Stranded Total RNA Library Prep with Ribo-Zero Gold kit and sequenced on Illumina HiSeq4000.

  Dataset EGAD50000001196

• Single cell analysis reveals new evolutionary complexity in uveal melanoma

  Uveal melanoma (UM) is a rare eye cancer that is highly aggressive and leads to metastatic death in up to half of patients. Here, we conduct droplet-based single-cell RNA sequencing of 59,915 neoplastic and non-neoplastic cells from 8 primary and 3 metastatic UMs. Single-cell VDJ sequencing of RNA is conducted to determine clonally expanded B/T- cell populations. Single-cell DNA sequencing of 1 primary and 1 metastasis is utilized.

  Study phs001861

• Whole-Exome Sequencing and Targeted DNA Sequencing of Matched Ocular Melanocytosis and Uveal Melanoma

  Ocular melanocytosis is the most important predisposing condition for the eye cancer uveal melanoma (UM). Here we used whole-exome and deep targeted sequencing to identify for the first time a clonal Gq pathway mutation in ocular melanocytosis, which gave rise to UM. Additionally, we elucidated the order in which canonical genetic aberrations were acquired during tumor evolution. These findings provide a mechanistic explanation for the well-known clinical association of ocular melanocytosis with UM, and they provide new insights into UM tumor evolution. Reprinted from: Durante MA, Field MG, Sanchez MI, Covington KR, Decatur CL, Dubovy SR, Harbour JW. Genomic evolution of uveal melanoma arising in ocular melanocytosis, with permission from Cold Spring Harbor Molecular Case Studies.

  Study phs001835

• Genomic characterization of esophageal squamous cell carcinoma reveals critical genes underlying tumorigenesis and poor prognosis

  The genetic mechanisms underlying the poor prognosis of esophageal squamous cell carcinoma (ESCC) are not well understood. In this study, we comprehensively characterized somatic mutations, copy number alterations (SCNAs)/structural variants (SVs) found in ESCC from sequencing 10 whole-genome and 57 whole-exome matched tumor-normal pairs. We identified multiple somatic mutations seen previously in known cancer pathways and identified candidate genes for ESCC including VANGL1 and MIR4707. A survival analysis based on the expression profiles of 321 ESCC individuals indicated that the somatically altered genes we found were significantly associated with ESCC poorer survival. Subsequently, we performed functional studies to validate the roles of the altered genes in tumor proliferation and metastasis.

  Study EGAS00001001723

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391