14983 results for "cancer studies using rna-seq"

in 14.11 milliseconds.

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Log2 normalized TPM matrix for POPLAR (GO28753)

  This dataset contains log2(TPM + 1) for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008390

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• 17 scRNAseq samples

  17 samples were processed for single cell RNA sequencing (SORT-seq)

  Dataset EGAD00001007523

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680

• RNASeq profiles of ROBUST clinical trial and processed WGS mutation calls output

  The dataset contains RNAseq profiles of 1040 patients from the ROBUST clinical trial (NCT02285062). The Allprep DNA/RNA FFPE kit was used to simultaneously purify genomic DNA and total RNA from formalin-fixed, paraffin embedded (FFPE) tissue sections. RNAseq libraries (75PE, 50M) were constructed using Illumina TruSeq RNA Access method. Fastq files are included. Also includes processed WGS mutation calls output.

  Dataset EGAD50000000482

• RNA Sequencing of Control and Myotonic Dystrophy Type 1 Cells During Myogenic Differentiation

  To investigate gene expression dynamics during myogenic differentiation in myotonic dystrophy type 1, RNA was collected from immortalized control, patient-derived, and CRISPR/Cas9-corrected myoblasts at proliferation (day -2) and at days 1 and 5 of differentiation. High-quality RNA was isolated and sequenced using poly(A)-enriched or rRNA-depleted protocols, yielding 100 bp paired-end reads with high coverage. A subset of samples at day 1 underwent deeper sequencing to enhance transcriptome resolution.

  Dataset EGAD50000001647

• Using RNA-sequencing to characterize the resistance to lirafugratinib

  In addition to Exome-sequencing, we used RNA-sequencing to also characterize resistance to lirafugratinib with whole exome sequencing in patients with FGFR2-driven cancers, treated in the phase 1/2 ReFocus trial (NCT04526106) and enrolled in the UNLOCK program at Gustave Roussy

  Study EGAS50000001370

• Single-cell RNA sequencing of erythroid and megakaryocytic acute myeloid leukemia patient cells

  Single-cell RNA sequencing was performed on bone marrow mononuclear cells of a patient with acute myeloid leukemia with erythroid differentiation of the blasts and on peripheral blood mononuclear cells of a patient with acute myeloid leukemia with megakaryocytic differentiation of the blasts. The dataset contains raw fastq files of these two samples with single-cell RNA sequencing performed using the 10x Genomics platform.

  Dataset EGAD00001009865

• Personalized Breast Cancer Vaccines Based on Genome Sequencing

  This study is from a phase I clinical trial of neoantigen DNA vaccines in triple negative breast cancer patients with persistent disease following neoadjuvant chemotherapy. The exome and RNA sequences used to identify somatic mutations, predict neoantigens, and design vaccines is within.

  Study phs002787