14989 results for "cancer studies using rna-seq"

in 15.94 milliseconds.

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Premalignant SOX2 overexpression in the fallopian tubes of ovarian cancer patients: Discovery and validation studies

  To identify early driver mutations in ovarian cancer cells, we used dense whole genome sequencing of micrometastases and microscopic residual disease collected at three time points from a single patient during treatment for high-grade serous ovarian cancer (HGSOC). Laser capture microdissection of tumour islets was performed on samples prior to chemotherapy, after three cycles of chemotherapy and at recurrence. Long frament read whole genome sequencing was performed and mutations were identified. To our knowledge, this is the first longitudinal study that attempts to investigate spatial and temporal micro-heterogeneity in cancer.

  Study EGAS00001001909

• Cancer sequencing for somatic variant calling

  This dataset includes WES and RNAseq for 11 patients with metastatic melanoma, lung, kidney, and stomach cancers, enrolled in phase I clinical trials of TIL ACT (NCT03475134 & NCT04643574). WES was performed on matched cancer and healthy tissues, whereas RNAseq was performed on cancer tissues, using Illumina HiSeq 2500/4000 and Illumina NextSeq 550 systems.

  Study EGAS00001007101

• Whole Genome DNA Methylation

  Whole Genome Bisulfite Sequencing on normal primary human uveal melanocytes. WGBS libraries were prepared using the Accel-NGS Methyl-Seq DNA Library Kit (Swift Biosciences 30024), the EZ DNA Methylation-Gold Kit (Zymo D5005), and DNA Clean & Concentrator-5 (Zymo D4013), following the instruction manual Accel-NGS Methyl-Seq DNA Library (Revision 160510). Paired-end (2 x 150 bp) libraries were sequenced on a DNBSEQ-T7 instrument (MGI) after library conversion.

  Dataset EGAD50000000766

• Whole Genome DNA Methylation MPI

  Whole Genome Bisulfite Sequencing on normal primary human uveal melanocytes. WGBS libraries were prepared using the Accel-NGS Methyl-Seq DNA Library Kit (Swift Biosciences, Catalog No. 30024), the EZ DNA Methylation-Gold Kit (Zymo, D5005) and DNA Clean & Concentrator-5 (Zymo, D4013), following the instruction manual Accel-NGS® Methyl-Seq DNA Library (Revision 160510). Paired-end libraries (2 × 150 bp) were sequenced on a NovaSeq 6000 instrument.

  Dataset EGAD50000001139

• DNA-seq FASTQ files from 16 patients affected by acute intermittent porphyria

  Paired-end DNA-seq FASTQ files from 16 patients affected by acute intermittent porphyria. Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). Each sample was multiplexed across flowcells and lanes, leading to a total number of 83 pairs of FASTQ files.

  Dataset EGAD00001006950

• Methylation profiling by MCC-Seq of visceral fat (N=199) and whole-blood (N=206) derived from IUCPQ participants

  The study includes NGS-based methylC-capture sequencing (MCC-Seq) on 199 visceral adipose tissue and 206 whole-blood DNA samples derived from obese individuals (BMI >40 kg m-2) in the IUCPQ cohort. We generated 100bp paired-end reads using the Illumina HiSeq2000 or 2500 systems.

  Dataset EGAD00001004787

• Comprehensive Genomic Characterization of Acral Melanoma

  In this study, we performed paired tumor/normal long insert whole genome and exome sequencing and tumor RNA sequencing on primary or metastatic acral melanoma tumors collected from 34 patients. Patients were enrolled from either Vanderbilt University or the Memorial Sloan-Kettering Cancer Center. We report an integrated analysis of DNA and RNA sequencing data to describe genomic and transcriptomic characteristics of acral melanoma.

  Study phs001036

• Small RNA sequencing of untreated and castration resistant prostate cancer

  Small RNA sequencing of 28 untreated prostate cancers, 12 castration resistant prostate cancers, and 3 benign prostatic hyperplasias.

  Dataset EGAD00001000611