15020 results for "cancer studies using rna-seq"

in 14.51 milliseconds.

• Bulk RNAseq FASTQ files of three PDAC organoid lines treated with LGK974 or DMSO for 24h

  This dataset contains raw FASTQ files from bulk RNA sequencing of three patient-derived pancreatic ductal adenocarcinoma (PDAC) organoid lines (P28, P40, P47). Each organoid line was treated with either the WNT secretion inhibitor LGK974 or DMSO for 24 hours, with three biological replicates per treatment condition. RNA was extracted using the Qiagen QiaSymphony SP system, and libraries were prepared with the Illumina Truseq stranded polyA kit. Sequencing was performed on an Illumina NextSeq2000 platform using single-end 50bp reads. Quality control was conducted with FastQC, and reads were trimmed with TrimGalore as appropriate. Data are controlled-access and intended for transcriptomic analysis of WNT pathway perturbation in PDAC organoid models.

  Dataset EGAD50000002219

• Single-cell multi-omics reveals clonal evolution and T-cell dynamics underlying differential responses to ibrutinib in Waldenström macroglobulinemia.

  To elucidate the molecular basis underlying differential response and resistance to ibrutinib in Waldenström’s macroglobulinemia (WM), we conducted a prospective phase II trial (NCT02604511) of ibrutinib monotherapy in treatment-naïve patients. Seventy-four sequential bone marrow (BM) aspirates from 17 patients, collected from baseline through 48 treatment cycles, were profiled using single-cell RNA and V(D)J sequencing.

  Study EGAS50000001596

• Capture Hi-C on Hodgkin lymphoma cell line L-428

  In situ promoter capture Hi-C on Hodgkin lymphoma cell line L-428 in experimental triplicates. Hi-C libraries were prepared as previously described (Orlando et al., 2018, https://currentprotocols.onlinelibrary.wiley.com/doi/pdf/10.1002/cphg.63). Promoter capture was based on 32,313 biotinylated 120-mer RNA baits (Agilent). Hi-C libraries were sequenced using Illumina HiSeq 2000 technology. The files are in FASTQ format.

  Study EGAS00001003032

• Single cell RNA sequencing of 33 primary colorectal cancer

  Study EGAS00001003779

• Dataset for colorectal_cancer-RNA

  Rare cancer sequencing data of 97 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008855

• Breast Cancer Family Registry

  The Breast Cancer Family Registry (BCFR) is a multi-center prospective cohort, comprised of over 30,000 women and men from nearly 12,000 families from the United States, Canada, and Australia. Our BCFR resource has been used, and continues to be used, by breast cancer researchers around the world in order to find new ways to prevent, diagnose, and treat cancer. The BCFR provides an extensive and diverse range of resources, expertise, and specialized skills, and has several unique strengths: 1) the collection of a large number of individuals and families across a wide spectrum of breast cancer risk, including both affected and unaffected individuals; 2) the large collection of families with early-onset breast cancer; 3) the large collection of racial/ethnic minority families not replicated elsewhere; 4) the extensive molecular characterization performed to date; and 5) active follow-up of both probands and family members. Thus, the BCFR comprises a unique cohort of probands and family members at familial/genetic risk of breast cancer that will continue to facilitate a wide range of research studies, such as gene discovery, examination of cancer-related outcomes and risk factors in high-risk subjects, investigation of novel behavioral interventions, and cancer prevention trials among at-risk family members. Consequently, the BCFR Cohort, as one of the few cohorts available worldwide with biospecimens and extensive molecular and genetic characterization, combined with epidemiologic data and long-term follow up, will be an invaluable resource for translational research in the genetic epidemiology of breast cancer.

  Study phs002835

• Colon Cancer Family Registry (Colon CFR)

  The Colon Cancer Family Registry Cohort (CCFRC www.coloncfr.org) is a cohort of families recruited through six study sites located in the USA, Canada, Australia, and New Zealand. The CCFRC was formed as a resource to support studies on the etiology, prevention, and clinical management of colorectal cancer. Recruitment protocols fall broadly into two main categories: population-based and clinic-based ascertainment. Between 1998 and 2013, the CCFR recruited and interviewed probands who were either recently diagnosed with colorectal cancer that was reported to state or regional population cancer registries in the United States (Washington, California, Arizona, Minnesota, Colorado, New Hampshire, North Carolina, and Hawaii), Australia (Victoria), and Canada (Ontario) or were from multiple-case families referred to family-cancer clinics in the United States (Mayo Clinic in Rochester, Minnesota, and Cleveland Clinic in Cleveland, Ohio), Australia (Melbourne, Adelaide, Perth, Brisbane, and Sydney), New Zealand (Auckland), and Canada. Cases with known familial adenomatous polyposis were excluded. Once recruited, probands were asked for permission to contact their relatives for recruitment. Collectively, we have enrolled 42,49874 participants in 15,048 families who participated in standardized protocols used to collect information regarding family cancer history and colorectal cancer risk factors and biospecimens. All participants of population-based case families (excluding control-families) and clinic-based families are asked to provide updates on their personal and family history of cancer as well as their history of surgery, cancer screening, and some risk factors every 4-5 years either by telephone interview or by self-completed questionnaire via mail or online (PMID: 17982118).

  Study phs002733

• Childhood B-cell acute lymphoblastic leukemia genomic and transcriptomic data

  The aim of the two studies was: 1) to genetically characterise childhood leukemia patients that lacked established cytogenetic abnormalities (termed B-other leukemia) and assess the clinical features of recurrent genetic abnormalities. 2) Assess the accuracy of whole genome sequencing as a diagnostic genetic test in childhood leukemia, relative to other traditional methods (karyotyping, FISH, MLPA) and whole transcriptome sequencing. As a result, this study includes targeted DNA-sequencing, whole genome sequencing and whole transcriptome sequencing data on childhood leukemia patients enrolled on UK clinical trials (UKALL2003 and UKALL2011).

  Study EGAS00001006863

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391