15160 results for "cancer studies using rna-seq"

in 15.24 milliseconds.

• Molecular Signatures of DCIS to Invasive Progression for Basal-Like Breast Cancers: An Integrated Mouse Model and Human Tumor Study

  We studied the genomic signatures of progression in breast ductal carcinoma in situ (DCIS) as it progresses towards triple negative invasive breast cancer (TNBC). Single cell RNA sequencing (scRNAseq) was performed on the C3Tag genetically engineered mouse model that forms human breast-like DCIS and TNBC. Bulk RNA sequencing was performed on RNA harvested from archival formalin-fixed, paraffin embedded (FFPE) pairs comprising of estrogen receptor (ER) positive (ER+) and negative (ER-) subsets of DCIS. 

  Study phs002443

• LEF1 knockdown effects on human T cell transcriptome and chromatin accessibility profiles.

  LEF1 (Lymphoid Enhancer-Binding Factor 1) is a key transcription factor in T cell development and function, and its dysregulation has been implicated in various immune-related disorders. This study aimed to comprehensively characterize the transcriptional and epigenetic changes induced by LEF1 knockdown in human T cells. CD3+ T cells isolated from three healthy donors were transfected with either LEF1-specific siRNA or control siRNA, followed by activation with CD3/CD28 Dynabeads and culture in IL-2-containing media. Cells were harvested at 24, 48 and 72 hours post-transfection for multi-omics analysis including bulk RNA-seq, bulk ATAC-seq, single-cell CITE-seq (For CITE-seq, 48 and 72 hours only). This dataset provides insights into LEF1-dependent gene regulatory networks and chromatin accessibility patterns in activated human T cells, contributing to our understanding of T cell biology and potential therapeutic targets. This dataset is part of a comprehensive study investigating functional roles of risk polymorphisms in autoimmune diseases, particularly focusing on the rs58107865 variant at the LEF1 locus.

  Study JGAS000818

• WGS of CTCs enriched using high-throughout microfluidic device from entire cancer patient leukopak

  Single-cell low-pass WGS analysis (illumina platform, PE150, 1-2x coverage) was performed on CTCs enriched using high-throughout microfluidic device from entire leukopak from patients with metastatic prostate cancer (GU-1 and GU-2) and metastatic hepatocellular carcinoma (HCC-1 and HCC-2).

  Study EGAS50000000723

• Paraganglioma Smart-Seq2 Single Nuclei Sequencing Data

  Paraganglioma is a rare neuroendocrine tumor that originates from chromaffin cells of the adrenal medulla or extra-adrenal paraganglia. This study aims to investigate the heterogeneity of this tumor and to identify potential biomarkers associated with its malignancy. To achieve this, we performed single-nucleus RNA sequencing of human paraganglioma samples using the SMART-Seq2 protocol.

  Study EGAS50000001184

• Targeted_sequencing_of_genes_recurrently_mutated_in_AML

  Background Massively parallel sequencing technology has transformed cancer genomics. It is now feasible, in a clinically relevant time-frame, for a clinically manageable cost, to screen DNA from patient tumours for mutations essentially genome-wide. The challenge for personalised medicine will be to increase the sample size to thousands or tens of thousands of well-characterised cases in order to attain sufficient statistical power to stratify patients accurately across the complexity and genomic heterogeneity expected for most of the common tumour types. Currently, whole genome sequencing on this scale is not feasible, and targeted sequencing of relevant portions of the genome will be required. Pilot data We have developed protocols for large-scale, multiplexed sequencing of 100-200 genes in thousands of samples. Essentially, using robotic technology, genomic DNA from the cancer specimen is processed into sequencing libraries with unique DNA barcodes, thereby allowing sequencing reads to be attributed to the sample they derive from. Currently, these sequencing libraries can be generated in a 96-well format using fully automated protocols, and we are exploring methods to expand this to a 384-well format. The sequencing libraries are pooled and hybridized to custom sets of RNA baits representing the genomic regions of interest. Sequencing of the pulled-down libraries is done in pools of 48-96 samples per lane of an Illumina Hi-Seq. This protocol is already implemented at the Sanger Institute. We have published proof that somatic mutations in novel cancer genes can be identified from exome-wide sequencing. In unpublished pilot data, we have established the feasibility of robotic library production, custom pull-down, and multiplexed sequencing of barcoded libraries for 100 known myeloid cancer genes across 760 myelodysplasia samples. Highlights of the data thus far analysed reveal that the coverage is remarkably even between samples; when 96 samples are run, average coverage per lane of sequencing is ~250, with 90-95% of targeted exons covered by >25 reads; known mutations can be discovered in the data set; and the protocol is amenable to whole genome amplified DNA. The bioinformatic algorithms for identification of substitutions and indels in pull-down data are well-established; we have pilot data proving that copy number changes, LOH and genomic rearrangements in specific regions of interest can also be identified by tiling of baits across the relevant loci. Proposal We propose to apply this methodology to 10000 samples from patients with AML enrolled in clinical trials over the last 10-20 years. Oncogenic point mutations and potentially genomic rearrangements will be identified, and linked to clinical outcome data, with a view to undertaking the following sorts of analyses: • Identification of co-occurrence, mutual exclusivity and clusters of driver mutations. • Correlation of prognosis with driver mutations and potentially gene-gene interactions • Exploration of genomic markers of drug response Ultimately, we would like to be in a position to release the mutation data together with matched clinical outcome data to genuine medical researchers via a controlled access approach, possibly within the COSMIC framework (www.sanger.ac.uk/genetics/CGP/cosmic/). The vision here is to generate a portal whereby a clinician faced with an AML patient and his / her mutational profile can obtain a ‘personalised’ prediction of outcome, together with a fair assessment of the uncertainty of the estimate. With a sufficient sample size, there would also be the potential to develop decision support algorithms for therapeutic choices based on such data.

  Study EGAS00001000408

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467