23214 results for "ega"

in 21.75 milliseconds.

• H3Africa ACEGID Omni Array Phenotype

  Phenotype data for Lassa Fever cases and population controls from Nigeria and Sierra Leone associated with genotype data generated using Illumina Omni 2.5M and 5M.

  Dataset EGAD00001010922

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Dataset RNA sequencing data of tumors from 85 patients with advanced or metastatic cancer treated with radio-immunotherapy

  RNA sequencing data from sequential biopsies obtained at baseline, week 3 (post-immuno, before SBRT), and week 7 (after SBRT)

  Dataset EGAD50000000958

• Young-Boost Whole Exome Sequencing (WES)

  Datasets associated with Young Boost Trial for Breast Cancer patients. Whole Exome Sequencing (WES) performed on 109 Samples (75 Tumor and 34 Normal). WES was performed to identify potential predictive biomarkers for treatment response.

  Dataset EGAD50000001171

• Analysis of cell type contributions to cell free DNA in health and disease.

  This study looks at cell type contributions to cell free DNA in health and disease.

  Study EGAS50000000178

• Studying the cellular diversity of the human hypothalamus

  We use single-cell and spatial transcriptomics to catalogue cellular populations and their locations in the human hypothalamus

  Study EGAS50000000716

• H3K27Ac ChIP-seq of 9 cHL cell lines

  The dataset contains 36 ChIP-seq data for H3K27Ac and their corresponging inputs for 9 cHL cell lines. Data are raw paired-end fasq files for each histone and input, and for each cell line.

  Dataset EGAD50000001272

• South African breast cancer GWAS genotype data in VCF format

  South African breast cancer GWAS genotype data for 2823 female African breast cancer cases. The data was generated using the H3Africa Custom microarray and genotyped on the Illumina HiScan instrument. The dataset is in VCF format.

  Dataset EGAD00010002732

• Clinical and ctDNA data for IMpassion031

  Clinical and ctDNA data for IMpassion031, including survival, response, and ctDNA data from baseline through post-surgery time points. 222 samples run on Signatera assay. File type is csv.

  Dataset EGAD50000001420