11076 results for "monedas ultimate team FC 26 Visité Buyfc26coins.com. Servicio premium a un precio estándar. Increíble..XLis"

in 25.95 milliseconds.

• Transcriptomic and Clonal Characterization of T Cells in the Human Central Nervous System

  The cerebrospinal fluid (CSF) is thought to be a main route for immune surveillance in the central nervous system (CNS). Understanding the composition and state of CSF in healthy individuals may provide insight into perturbations present during neuroinflammation. Here, we have used single-cell RNA and TCR sequencing to profile CSF and peripheral blood mononuclear cells (PBMCs) from healthy individuals and patients with relapsing-remitting multiple sclerosis (MS), a chronic autoimmmune disease. In addition, with the goal of understanding how transcriptional artefacts are introduced in transcriptomics experiments, we have performed single-cell and TCR sequencing to profile PBMCs from a healthy individual that were processed with the same enzymatic digestion used for tissues (such as the brain) in the presence or absence of transcription inhibitors. 

  Study phs002222

• Hereditary Cancer Predisposition Syndromes and Uveal Melanoma

  Uveal melanoma (UM) is a subtype of melanoma characterized by the strong contribution of genetic rather than environmental factors in the pathogenesis of the disease, making it an ideal model disease to study the genetic basis of cancer. The long-term goal of our laboratory is to determine the genes and mechanisms responsible for hereditary cancer predisposition associated with UM. BAP1 has been identified as a candidate gene with definitive association with predisposition to UM. However, pathogenic variants in BAP1 are detected in only a small subset of UM patients even those with strong personal and family history of cancer suggesting the existence of other candidate genes. The goal of this project is to identify novel candidate genes contributing to hereditary predisposition to UM in patients with no detectable germline pathogenic variant in BAP1.

  Study phs001943

• Somatic Mutations in Epilepsy: Whole Genome Sequence Analysis of Single Neurons

  Low-coverage whole-genome sequencing was performed on single-cells from resected brain tissues obtained from an individual with hemimegalencephaly (HMG) along with a somatic copy number variant (sCNV) of chromosome 1q in order to characterize the sCNV at the single cell level. Single neuronal nuclei and non-neuronal nuclei were isolated by fluorescence-activated cell sorting (FACS) using NeuN immunoreactivity to identify neurons. 46 neurons and 30 non-neuronal cells, as well as a batch of 10 and a batch of 100 cells from each group, were genome amplified using multiple displacement amplification (MDA) and sequenced on an Illumina HiSeq 2000 sequencer. Thirty-two samples were multiplexed into each HiSeq lane for single-end 50 bp runs, obtaining ~5 million pass-filter reads per sample.

  Study phs002615

• The Oral Microbiome and Head and Neck Cancer

  Oral microbiota may influence head and neck squamous cell carcinoma (HNSCC) development, potentially related to carcinogen metabolism. The human oral cavity hosts a diverse microbiota, including bacteria and fungi. We performed shotgun sequencing and ITS1 sequencing on 236 HNSCC case participants who developed HNSCC during a mean follow-up of 5.1 years and 458 matched controls who remained HNSCC-free. Oral samples were obtained from a prospective nested case-control study within three epidemiological cohorts: the American Cancer Society Cancer Prevention Study II Nutrition Cohort (ACS CPS-II), the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial (PLCO), and the Southern Community Cohort Study (SCCS). Control participants were selected using 2:1 frequency matching based on cohort, age, sex, race and ethnicity, and time since oral sample collection.

  Study phs004018

• Single-Cell Atlas of Human Liver and Blood Immune Cells Across Fatty Liver Disease Stages

  The goal of the study was to investigate immunological correlates of human fatty liver disease progression. We generated a single-cell RNA-seq (scRNA-seq) atlas of immune cells from liver fine needle aspirates (FNAs) and paired peripheral blood mononuclear cells (PBMCs) from a full-spectrum Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD)/Metabolic Dysfunction-Associated Steatohepatitis (MASH) human cohort, using the 3' 10X Genomics platform. Using computational analyses to assess changes in cellular frequencies and function, we found heightened immunoregulatory programs with profibrotic potential alongside a shift from antigen-specific to natural killer cytotoxic functions in the liver with MASH progression. Available data include raw single-cell transcriptomic data (FASTQ files) for each sample type (PBMC, FNA) per patient alongside clinical and histological measurements of fatty liver disease.

  Study phs004044

• exploration of biomarkers discriminating squamous cell carcinoma from other lung cancers

  Targeted therapies based on the molecular and histological features of cancer types are becoming standard practice. The most effective regimen in lung cancers is different between squamous cell carcinoma (SCC) and adenocarcinoma (AD). Therefore a precise diagnosis is crucial, but this has been difficult, particularly for poorly differentiated SCC (PDSCC) and AD without a lepidic growth component (non-lepidic AD). Biomarkers enabling a precise diagnosis are therefore urgently needed. To achieve this goal, we initially performed CAGE (Cap Analysis of Gene Expression) to quantify promoter activities on 97 frozen tissues from surgically resected lung cancers (22 SCC and 75 AD). We furhter expanded the transcriptome profiling to cover additional 48 malignant neoplasm of bronchus and lung, including mesothelioma and metastatic lung cancers derived from other tissues.

  Study JGAS000488

• Transcriptomic profiling of circulating regulatory T cells from follicular lymphoma patients before and after Lenalidomide treatment

  Lenalidomide has demonstrated a favorable efficacy profile in follicular lymphoma (FL) in combination with anti-CD20 antibodies. However, in vivo administration of Lenalidomide in FL patients triggers a proliferation of functional regulatory T cells (Tregs), and a high percentage of Tregs before and along the course of treatment with Lenalidomide/anti-CD20 combination is of poor prognosis. In this study, we evaluated the impact of Lenalidomide on circulating Treg in 3 FL patients using single cell RNA sequencing (scRNAseq). For this purpose, we took advantage of the GALEN clinical trial (NCT01582776), where Lenalidomide was initiated one week before starting the anti-CD20 antibody Obinutuzumab, allowing us to compare the transcriptomic profile of immune cells before (D0) and at day 7 (D7) of treatment by Lenalidomide alone.

  Study EGAS50000001048

• Germline Aberrations of PAX5 Cause Susceptibility to pre-B cell Acute Lymphoblastic Leukemia

  A novel heterozygous germline variant, c.547G>A (p.Gly183Ser), in the paired box protein encoding gene, PAX5, was found to segregate with disease in two unrelated kindreds with autosomal dominant pre-B cell acute lymphoblastic leukemia (ALL). Leukemic cells from both families exhibited 9p deletion, with loss-of-heterozygosity and retention of the mutant PAX5 allele at 9p13 . Two additional sporadic ALL cases with 9p loss demonstrated PAX5 Gly183 substitution in the leukemic cells. Functional analysis of the PAX5 germline variants demonstrated reduced transcriptional activity, as well as decreased interaction with Groucho-4. These data extend the role of PAX5 alterations in the pathogenesis of pre-B ALL, and implicate PAX5 in a novel syndrome of germline susceptibility to pre-B cell neoplasia.

  Study EGAS00001000447

• 10x genomics single cell RNA-seq and ATAC-seq from 10 pre-menopausal patients fimbriae and ampullary part of the fallopian tube

  The fallopian tube, connecting the uterus with the ovary, is a dynamic organ that undergoes cyclical changes and is the site of several diseases, including serous cancer. Here, we use single-cell technologies to construct a comprehensive cell map of healthy pre-menopausal fallopian tubes, capturing the impact of the menstrual cycle and menopause on different fallopian tube cells at the molecular level. The comparative analysis between pre- and post-menopausal fallopian tubes reveals substantial shifts in cellular abundance and gene expression patterns, highlighting the physiological changes associated with menopause. Further investigations into menstrual cycle phases illuminate distinct molecular states in secretory epithelial cells caused by hormonal fluctuations. The markers we identified characterizing secretory epithelial cells provide a valuable tool for classifying ovarian cancer subtypes.

  Study EGAS50000000628

• Clinical relevance of TCGA subtypes for gastric cancer patients

  There is a clinical need for the availability of molecular biomarkers in the tratment of gastric cancer (GC), since survival rates remain poor with a 5-year survival rate of only ~`40% for patients with resectable disease. These markers will elad to a more tailored approach in the treatment of GC, which enhances efficacy and reduces toxicity. Recently, The Cancer Genome Atlas (TCGA) classified GC patients into four molecular subgroups: Epstein Barr Virus positive (EBV+), genomically stable (GS), microsatellite instable (MSI), and chromosomal instable (CIN). For this purpose we aim to collect tumor tissue blocks from patients who participated in the Dutch D1/D2 or the CRITICS trial and who gave informed consent for translational studies. Associations between TCGA subtypes and outcomes to these different therapeutic options will be analyzed.

  Study EGAS50000000779

• ECM-free patient-derived organoids preserve diverse prostate cancer lineages and uncover in vitro-enriched cell types

  Patient-derived organoids (PDOs) hold promise for modeling various cancers, yet their application in prostate cancer (PCa) has been limited due to low culture success and the predominance of non-tumor-like cells. Using 164 PCa samples and optimizing culture conditions, we demonstrate that an extracellular matrix (ECM)-free culture method improves PDO take-rates, fostering cell populations with luminal and PCa-specific characteristics. Single-cell RNA sequencing (scRNA-seq) reveals that these ECM-free PDOs closely mirror their original tumors at the transcriptomic level and maintain a diverse array of tumor cell types, unlike traditional Matrigel-based cultures which predominantly yield benign-like cells. This study introduces a PCa PDO single-cell atlas, providing a valuable resource for advancing prostate cancer research.

  Study EGAS50000000807

• Whole-exome sequencing of breast cancer metastasis and corresponding blood samples

  This study included samples from metastatic breast cancer patients who underwent a biopsy in the context of SAFIR01 (NCT01414933), SAFIR02 (NCT02299999), SHIVA (NCT01771458) and MOSCATO (NCT01566019) prospective trials. These French multicentre trials used high throughput genome analysis on fresh frozen tumor biopsies as a therapeutic decision tool for metastatic cancer patients, with solid cancers (SHIVA, MOSCATO) or specifically with breast cancer (SAFIR01, SAFIR02). All patients gave their informed consent for translational research and genetic analyses of their somatic DNA. Overall, whole-exome sequencing for a total of 216 pairs of metastatic tumor and unmutated DNA derived from corresponding blood samples was performed using Illumina technology. The results of the analysis of the mutational profile of metastatic breast cancer was reported in Lefebvre et al. (PMID:28027327).

  Study EGAS00001001695

• Tumor-associated preferred end coordinates and somatic variants as signatures of circulating tumor DNA

  Cell-free DNA fragmentation is a nonrandom process. We showed that cell-free DNA fragments with ends at certain genomic coordinates had higher likelihoods of being derived from hepatocellular carcinoma. Other coordinates were associated with cell-free DNA molecules originating from the liver. Quantitative assessment of cell-free DNA molecules bearing these respective groups of end signatures correlated with the amounts of tumor-derived or liver-derived DNA in plasma. There were millions of tumor-associated plasma DNA end coordinates across the genome. Due to their high prevalence, they were more readily detectable than somatic mutations as a cancer signature in plasma. Hence, detection of tumor-associated plasma DNA ends may offer a cost-effective means of capturing evidence for the presence of cancer through liquid biopsy assessment.

  Study EGAS00001003160

• Pediatric Low-Grade Glioma RNA and Targeted Sequencing

  Pediatric low-grade gliomas (pLGG) are frequently driven by genetic alterations in the RAS/MAPK pathway yet show unexplained variability in their clinical outcome. To address this, we characterized a cohort of >1,000 clinically annotated pLGG. 84% of cases harbored a driver alteration, while those without an identified alteration also often exhibited up-regulation of the RAS/MAPK pathway. pLGG could be broadly classified based on their alteration type. Rearrangement-driven tumors were diagnosed at a younger age, enriched for WHO grade I histology, infrequently progressed, and rarely resulted in death as compared to SNV-driven tumors. Further sub-classification of clinical-molecular correlates stratified pLGG into risk categories. These data highlight the biological and clinical differences between pLGG subtypes and opens avenues for future treatment refinement.

  Study EGAS00001004242

• Loss-of-activity-mutation in the cardiac chloride-bicarbonate exchanger AE3 causes short QT syndrome

  Patients with short QT syndrome (SQTS) may present with syncope, ventricular fibrillation or sudden cardiac death. Six SQTS susceptibility genes, encoding cation channels, explain less than 25% of SQTS cases. Here we identify a missense mutation in the anion exchanger (AE3)-encoding SLC4A3 gene in two unrelated families with SQTS. The mutation causes reduced surface expression of AE3 and reduced membrane bicarbonate transport. Slc4a3 knockdown in zebrafish causes increased cardiac pHi, short QTc, and reduced systolic duration, which is rescued by wildtype but not mutated SLC4A3. Mechanistic analyses suggest that an increase in pHi and decrease in [Cl-]i shortened the action potential duration. However, other mechanisms may also play a role. Altered anion transport represents a mechanism for development of arrhythmia and may provide new therapeutic possibilities.

  Study EGAS00001002632

• Germline SDHB-inactivating mutation in gastric spindle cell sarcoma (HIPO-021)

  Gastrointestinal stromal tumors (GISTs) are the most frequent mesenchymal tumors of the gastrointestinal tract. Inactivating mutations or epigenetic deregulation of succinate dehydrogenase complex (SDH) genes are considered defining features of a subset of GIST occurring in the stomach. Based on comprehensive molecular profiling and biochemical analysis within a precision oncology program, we identified hallmarks of SDH deficiency (germline SDHB-inactivating mutation accompanied by somatic loss of heterozygosity, lack of SDHB expression, global DNA hypermethylation, and elevated succinate/fumarate ratio) in a 40-year-old woman with undifferentiated gastric spindle cell sarcoma that did not meet the diagnostic criteria for other mesenchymal tumors of the stomach, including GIST. These data reveal that the loss of SDH function can be involved in the pathogenesis of non-GIST sarcoma of the gastrointestinal tract.

  Study EGAS00001004277

• Persistent Mutation Burden Drives Sustained Anti-Tumor Immune Responses

  Tumor mutation burden is an imperfect proxy of tumor foreignness and has therefore failed to consistently demonstrate clinical utility in predicting responses in the context of immunotherapy. We evaluated mutations in regions of the genome that are unlikely to undergo loss and discovered that clonal mutations in single-copy regions and those present in multiple copies per cell constitute a persistent tumor mutation burden (pTMB) that is linked with therapeutic response to immune checkpoint blockade. Persistent mutations were retained in the context of tumor evolution under selective pressure of immunotherapy and tumors with a high pTMB content were characterized by a more inflamed tumor microenvironment. pTMB imposes an evolutionary bottleneck that cancer cells cannot overcome and may thus drive sustained immunologic tumor control in the context of immunotherapy.

  Study EGAS00001006660

• Multiple migrations to the Philippines during the last 50,000 years

  A key link to understand human history in Island Southeast Asia is the Philippine archipelago and its poorly investigated genetic diversity. We collected and analyzed the most comprehensive set of population-genomic data for the Philippines, 1028 individuals covering 115 indigenous communities. We demonstrate that the Philippines were populated by at least five waves of human migration. The Cordillerans migrated into the Philippines prior to the arrival of rice agriculture, where some remain to be the least admixed East Asians carrying an ancestry shared by all Austronesian-speaking populations; thereby challenging an exclusive Out-of-Taiwan model of joint farming-language-people dispersal. Altogether, our findings portray Philippines as a crucial gateway, with a multilayered history, that ultimately changed the genetic landscape of the Asia-Pacific region.

  Study EGAS00001005083

• The Iberian Roma genetic variant server

  The Roma are the most numerous ethnic minority in Europe. The Iberian Roma arrived in the Iberian Peninsula five centuries ago and still today, they keep a strong group identity. Demographic and cultural reasons lie behind a high rate of Mendelian disease often related to founder variants. We have analysed exome data from 119 Iberian Roma individuals collected from 2018 to 2020. A database of variant frequency has been implemented (IRPVS) and made available online. We have analysed the carrier rate of founder private alleles as well as pathogenic variants present in the general population. Significant enrichment in structural variants involving gene clusters related to keratinization and epidermal growth suggest that evolutive mechanisms have developed towards climate and environmental adaptation. IRPVS can be accessed at http://irpvs.clinbioinfosspa.es/

  Study EGAS00001006758

• GCparagon: Evaluation and correction of GC biases in cell-free DNA at the fragment level

  We present GCparagon, a two-stage algorithm for computing and correcting GC biases in cell-free DNA (cfDNA) samples. The length of the highly fragmented cfDNAs and the number of GC bases are essential parameters in the calculations. Regions of low mappability, known reference genome assembly errors and regions surrounding assembly gaps are excluded from the bias computation. GCparagon outputs a bias matrix and an optional tagged BAM file with GC bias balance weights as alignment tags. Parallelization allows calculation of a GC bias estimate in less than 2 minutes per sample with between 99.0% and 99.9% of fragments already corrected. We propose that GCparagon can help standardize cfDNA applications and evaluate the impact of GC bias on algorithms used in the analysis of liquid biopsy data.

  Study EGAS00001006963

• Evolutionary landscape of clonal hematopoiesis in 3359 individuals from the general population

  This project contains longitudinal data for processed somatic variant calls and data on core phenotypic variables for 3359 community-based individuals ≥60 years, a sub-cohort of the population-based Lifelines cohort (167,729 participants). Cases with peripheral blood count abnormalities and population-based controls were included. Next-generation sequencing data were generated with a median time period of 43 months between baseline and follow-up visit. For 327 individuals a third visit sample was included. Error-corrected sequencing was performed using single-molecule tagged molecular inversion probes targeting 27 myeloid and lymphoid driver genes. The threshold for variant calling was set at ≥1% VAF and ≥10 consensus variant reads. Details on sample selection, sequencing technique, variant calling procedures and data curation are described (van Zeventer et al. 2023).

  Study EGAS00001007087

• Transcriptome human nasal epithelium

  1. Odors are detected, firstly, by olfactory sensory neurons (OSNs) in the olfactory epithelium of the nose. This neurons then project directly to the olfactory bulb in the brain. Olfaction depends on cellular regeneration of the OE, olfactory bulb and hippocampus, and on their continual re-wiring. The olfactory neural pathway includes regions of the frontal, temporal and limbic brain, which in turn overlap with brain areas involved in brain disorders. OSNs are the only aspect of the human brain exposed to the external environment. This not only makes them vulnerable to environmental changes, but also accessible for biomedical studies. We have already sequenced and developed a protocol for analyzing the transcriptome of mouse main olfactory epithelium and single OSNs. We propose here to perform a similar study for samples from the human olfactory epithelium. We have developed a minimally invasive method for obtaining human OSNs, among other cells from the nasal epithelium. In this experiment, we have obtained cell samples from the olfactory epithelium, including OSN, from healthy volunteers. We would like to further characterize them by RNA sequencing. This will give us valuable insight into human olfaction. It will also provide a first step into a new avenue to study, and find biomarkers for, brain diseases though the analysis of these easily available neurons. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Dataset EGAD00001002226

• Direct Comparative Analysis of 10X Genomics Chromium and Smart-seq2

  Single cell RNA sequencing (scRNA-seq) is widely used for profiling transcriptomes of individual cells. The droplet-based 10X Genomics Chromium (10X) approach and the plate-based Smart-seq2 full-length method are two frequently-used scRNA-seq platforms, yet there are only a few thorough and systematic comparisons of their advantages and limitations. Here, by directly comparing the scRNA-seq data by the two platforms from the same samples of CD45- cells, we systematically evaluated their features using a wide spectrum of analysis. Smart-seq2 detected more genes in a cell, especially low abundance transcripts as well as alternatively spliced transcripts, but captured higher proportion of mitochondrial genes. The composite of Smart-seq2 data also resembled bulk RNA-seq data better. For 10X-based data, we observed higher noise for mRNA in the low expression level. Despite the poly(A) enrichment, approximately 10-30% of all detected transcripts by both platforms were from non-coding genes, with lncRNA accounting for a higher proportion in 10X. 10X-based data displayed more severe dropout problem, especially for genes with lower expression levels. However, 10X-data can better detect rare cell types given its ability to cover a large number of cells. In addition, each platform detected different sets of differentially expressed genes between cell clusters, indicating the complementary nature of these technologies. Our comprehensive benchmark analysis offers the basis for selecting the optimal scRNA-seq strategy based on the objectives of each study.

  Dataset EGAD00001005448

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Discordant_Monozygotic_Twins_ALS (Epigenetics)

  We conducted a multi-omics study on a monozygotic twin pair discordant for amyotrophic lateral sclerosis. Data refers to 7 samples that are technical replicates from biological samples collected from the twins at two different time points (T1 and T2).

  Dataset EGAD00010002716

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• WTCCC2 Pre-eclampsia Study

  A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.

  Study EGAS00001003349

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  Dataset EGAD00001006877

• Bladder Cancer Organoids as a Functional System to Model Different Disease Stages and Therapy Response

  The study 'Bladder Cancer Organoids as a Functional System to Model Different Disease Stages and Therapy Response' reports the genomic characterization at the single allele level upon Whole Exome Sequencing of Bladder Cancer (BLCa) Patient Tumor (PT) samples obtained from 18 patients and corresponding Patient Derived Organoids (PDOs), implementing the SPICE pipeline (Ciani Y et al). Our cohort included 21 PTs and 22 PDOs. In this study, we generated a unique biobank resource of BLCa organoids that encompasses a broad spectrum of disease stages. We demonstrated that PDOs retain cancer heterogeneity and mutational burden. Furthermore, we observed that BLCa PDO can have different morphologies which may reflect tumor-specific features. Indeed, a solid morphology may be associated with more advanced tumors, as supported by the high PDO genomic burden and high primary tumor stage. Moreover, with our drug screening pipeline, we demonstrated the clinical relevance and feasibility of using a BLCa PDO-based drug assay for comparing the standard of care (SOC) drugs with compounds not currently in use for BLCa. Response to SOC was highly heterogeneous with approximately 50% of non-muscle invasive bladder cancer and 33% of muscle invasive bladder cancer PDOs showing no or minimal response. The most effective targeted therapy was lapatinib. We used an integrative analysis of drug response profiles with matched PDO genomic analysis to determine enrichment thresholds for candidate markers of therapy resistance and sensitivity. Importantly, by assessing the clinical history of longitudinally sampled cases, the clonal evolution of the disease could be determined and matched with PDO drug response profiles.

  Study phs003149

• Genomic Studies of Bipolar Disorder in a Large Cohort from The Netherlands

  The transcriptomes of whole blood samples of a large cohort of individuals from the Netherlands were assayed using RNA-seq. These whole blood samples included patients diagnosed with schizophrenia or bipolar disorder, family members of patients, and healthy controls. Within the whole blood dataset, about 600 of the samples were sequenced to an average of 13.9 million mapped reads per sample, while about 2,000 were sequenced to an average of 5.9 million mapped reads per sample, in order to assess changes in power to detect eQTLs based on sample size. We find that expression, defined as the log transcripts per million reads (TPMs), is highly correlated when comparing the moderate (13.9M) and lower (5.9M) coverage datasets. Additionally, a subset of about 150 individuals provided fibroblast cell lines which were assessed for the levels of gene expression using RNA-seq at an average of 50 million mapped reads per sample. We use downsampling techniques to generate synthetic datasets derived from this real fibroblast RNA-Seq data to explore the relationship between coverage and number individuals in an eQTL analysis. Corresponding individual-level genotypes for the samples included in the expression matrix are also made available. The genotypes were derived from multiple other project cohorts, each using different genotyping platforms including OmniExpress Exome, Global Screening Array, Illumina550, and PsychChip. A Plink file set of these cohorts is provided here after merging the separate project file sets and extracting only the individuals who have expression data also provided here; quality control for SNP-missingness is recommended. We demonstrate in this study that given a fixed budget, eQTL discovery power can be increased by lowering the sequencing depth per sample to allow for an a greater number of individuals sequenced. 

  Study phs002856

• The Human Phenotype Project (HPP) is a large-scale deep-phenotype prospective longitudinal and ethnically diverse cohort

  The Human Phenotype Project (HPP) is a large-scale deep-phenotype prospective longitudinal and ethnically diverse cohort and biobank that we established. To date, approximately 28,000 participants have enrolled in the study, with over 13,000 having completed their initial visit. The project is aimed at identifying novel molecular signatures with diagnostic, prognostic and therapeutic value, and at developing AI-based predictive models for disease onset and progression. A unique feature of the HPP is its deep and longitudinal profiling that includes medical history, lifestyle and nutritional habits, vital signs, anthropometrics, blood tests, continuous glucose and sleep monitoring, imaging modalities and molecular profiling of the transcriptome, genetics, gut, vaginal and oral microbiome, metabolome and immune system. For several of these modalities, the HPP is the first or largest cohort of its kind. Our analyses of this data provide novel insights into the variation of phenotypes with age and ethnicity, highlighting the importance of having ethnically diverse cohorts and the need for establishing age-dependent norms. We demonstrate how the HPP can be used to unravel personalized molecular signatures of disease by comparison to patient-specific and disease-specific matched healthy controls. Leveraging the extensive dietary and lifestyle HPP data, we systematically identify associations between lifestyle factors and health outcomes. Finally, we present a multi-modal foundation AI model that is trained using self-supervised learning on diet and CGM data and outperforms existing methods in predicting future onset of disease. We extend this AI framework to integrate all data modalities of each subject as a continuous sequence of diverse medical events, creating a digital twin that can simulate interventions and predict health trajectories and outcomes.

  Study EGAS00001008040

• Whole genome sequencing of a breast cancer cohort with known functional homologous recombination status

  Optimal patient selection for PARP inhibitors and double strand break (DSB) inducing chemotherapy is of great clinical importance. In principle, the use of these therapies can be extended beyond germline BRCA1/2 mutated cancers. Although several methods for detection of BRCA-like tumors have been developed, a golden standard is lacking. We have developed the RECAP test, a functional HR assay exploiting the formation of RAD51 foci in proliferating cells after ex vivo irradiation of fresh primary breast cancer (BrC) tissue. The RECAP test seems robust and has an advantage over genetic tests, due to its functional character for exploring the HR phenotype. Another type of HRD test is the BRCAness classifier, which is based on specific genomic patterns derived from copy number data of BRCA1/2 mutated BrCs that also occur in sporadic cancers. The BRCAness classifier is a robust test that is easily applicable in the clinic and has also been validated to predict in vivo response to high dose chemotherapy in clinical trials. More recently, a new HRD test based on genomic signatures which can be extracted from whole genome sequencing has been published, HRDetect. Studies comparing these different HRD tests within the same cohort of patients do not yet exist. Here, we have the unique opportunity to compare three HRD tests within the same cohort. We aim to compare three different HRD tests (RECAP, BRCAness classifier and HRDetect) within the same cohort of primary BrCs (n=41). As a secondary aim, we will analyze additional genetic alterations in HRD tumors (both BRCA-deficient and BRCA-proficient HRD tumors).

  Study EGAS00001005572

• A catalog of the genetic causes of Hereditary Angioedema in the Canary Islands (Spain)

  Hereditary angioedema (HAE) is a rare disease where known causes involve C1 inhibitor dysfunction or dysregulation of the kinin cascade. The updated HAE management guidelines recommend performing genetic tests to reach a precise diagnosis. Unfortunately, genetic tests are still uncommon in the diagnosis routine. Here, we characterized for the first time the genetic causes of HAE in affected families from the Canary Islands (Spain). Whole-exome sequencing data was obtained from 41 affected patients and unaffected relatives from 29 unrelated families identified in the archipelago. The Hereditary Angioedema Database Annotation (HADA) tool was used for pathogenicity classification and causal variant prioritization among the genes known to cause HAE. Manual reclassification of prioritized variants was used in those families lacking known causal variants. We detected a total of eight different variants causing HAE in this patient series, affecting essentially SERPING1 and F12 genes, one of them being a novel SERPING1 variant (c.686-12A>G) with a predicted splicing effect which was reclassified as likely pathogenic in one family. Altogether, the diagnostic yield by assessing previously reported causal genes and considering variant reclassifications according to the American College of Medical Genetics guidelines reached 66.7% (95% Confidence Interval [CI]: 30.1-91.0) in families with more than one affected member and 10.0% (95% CI: 1.8-33.1) among cases without family information for the disease. Despite the genetic causes of many patients remain to be identified, our results reinforce the need of genetic tests as first-tier diagnostic tool in this disease, as recommended by the international WAO/EAACI guidelines for the management of HAE.

  Study EGAS00001006547

• A transcriptomic approach to understand patient susceptibility to pneumonia after abdominal surgery

  Rationale Nosocomial infections are a major healthcare challenge, developing in over 20% of patients aged 45 or over undergoing major-abdominal surgery, with postoperative pneumonia associated with an almost five-fold increase in 30-day mortality. Objectives To describe immune-pathways and gene-networks altered following major-abdominal surgery and identify transcriptomic patterns associated with postoperative pneumonia. Methods and Measurements From a prospective consecutive cohort (n=150) undergoing major-abdominal surgery whole-blood RNA was collected preoperatively and at three time-points postoperatively (2-6, 24 and 48hrs). Twelve patients diagnosed with postoperative pneumonia and 27 matched patients remaining infection-free were identified for analysis with RNA-sequencing. Main Results Compared to preoperative sampling, 3,639 genes were upregulated and 5,043 downregulated at 2-6hrs. Pathway-analysis demonstrated innate-immune activation with neutrophil-degranulation and Toll-like-receptor signalling upregulation alongside adaptive-immune suppression. Cell-type deconvolution of preoperative RNA-sequencing revealed elevated S100A8/9-high neutrophils alongside reduced naïve CD4 T-cells in those later developing pneumonia. Preoperatively, a gene-signature characteristic of neutrophil-degranulation was associated with postoperative pneumonia acquisition (P=0.00092). A previously reported Sepsis Response Signature (SRSq) score, reflecting neutrophil-dysfunction and a more dysregulated host response, at 48hrs postoperatively, differed between patients subsequently developing pneumonia and those remaining infection-free (P=0.045). Analysis of the novel neutrophil gene-signature and SRSq scores in independent major-abdominal surgery and polytrauma cohorts indicated good predictive performance in identifying patients suffering later infection. Conclusions Major-abdominal surgery acutely upregulates innate-immune pathways while simultaneously suppressing adaptive-immune pathways. This is more prominent in patients developing postoperative pneumonia. Preoperative transcriptomic signatures characteristic of neutrophil-degranulation and postoperative SRSq scores may be useful predictors of subsequent pneumonia risk.

  Study EGAS00001007229

• Transcriptome of Chronic Pain and Disease

  The Functional Genomics Section (FGS) is a part of the National Institute of Dental and Craniofacial Research (NIDCR) within the National Institutes of Health (NIH). Research at the FGS focuses on understanding the mechanics involved in nociception through both clinical samples from patients with chronic pain and mouse models of pain. Pain is relayed from the periphery to the central nervous system through specialized sensory neurons known as nociceptors. The cell body of nociceptors resides in neuronal structures that branch off of the spinal cord known as dorsal root ganglia (DRG). The DRG is a heterogenous tissue containing not only sensory neurons like nociceptors, but also glial cells, capillaries, fibroblasts, and resident macrophages. The interaction between the nociceptors and these DRG cell types can have a significant role in affecting neuronal hyperexcitability and downstream pain sensitivity. To better understand the cellular factors involved in producing conditions of chronic pain, DRGs from consenting organ donors were collected from individuals experiencing pain disorders such as painful diabetic neuropathy and rheumatoid arthritis. A multi-omics approach is being used to identify molecular mechanisms that lead to pain hypersensitivity in patients with chronic pain.  

  Study phs002548

• Whole Exome Sequencing in Alopecia Areata Identifies Rare Mutations in KRT82

  Alopecia areata (AA) is an autoimmune disorder, in which the body's own immune cells attack hair follicels resulting in hair loss. It is a complex genetic disease with 14 associated loci previously identified in our genome-wide association study (GWAS). In the study, we performed the whole-exome sequencing (WES) on 849 AA patients with the aim to identify the novel rare variants in genes contributing to AA susceptibility. We performed gene-collapsing analyses and identified keratin 82 (KRT82 Gene ID: 3888) as the highest associated AA gene in the three rare damaging collapsing models with p<6.7E-07 in one of the models. The KRT82 gene is a hair-specific type II keratin expressed in the hair shaft cuticle during the anagen phase of the hair cycle. We reported the lower expression of KRT82 in AA hair follicles, compared to controls, and the KRT82 expression is absent from the bulb region, the site of AA immune attack. This study emphasizes the significance of using WES and gene collapsing analyses to identify rare variation in a functionally relevant risk gene using a moderate sample size.  

  Study phs002632

• Whole Genome Sequencing in the Inner City Asthma Consortium (ICAC) Cohorts

  We performed whole-genome sequencing on individuals from the Asthma Phenotypes in the Inner City (APIC) and Urban Environment and Childhood Asthma (URECA) study cohorts, which consist of children with asthma who live in low-income neighborhoods across 10 U.S. cities. APIC was a one-year, prospective, observational study of children ages 6-17 with asthma. URECA was a prospective, observational study featuring a birth cohort of children with a high risk of developing asthma based on family history. We performed whole-genome sequencing on 1,035 individuals (ages 5-17 yrs; 67% Black, 25% Hispanic; 66% with MD-diagnosed asthma; APIC=508, URECA=527). Sequence read processing, quality control, and variant calling were performed using the Genome Analysis Toolkit suite (GATK v4). Variant call sites were annotated according to the filters applied in our common variant (minor allele frequency ≥ 1%) association studies, based on predicted false positive rates, genotype quality and depth, and population-adjusted Hardy-Weinberg equilibrium. Principal components of ancestry were calculated using high quality, linkage-disequilibrium-pruned single-nucleotide variants, accounting for subject relatedness, using PC-Air and PC-Relate.

  Study phs002921

• Whole Genome Association Study of Systemic Lupus Erythematosus

  The goal of this collaborative study was to identify new genetic risk factors for Systemic Lupus Erythematosus (SLE). To do this we conducted a genome-wide scan by combining the resources and expertise from a number of SLE researchers to establish a large sample set comprising 1311 SLE cases and 3340 controls. The SLE case samples were genotyped from the following collections: 338 subjects from the Autoimmune Biomarkers Collaborative Network (ABCoN), an NIH/NIAMS funded repository, 141 subjects from the Multiple Autoimmune Disease Genetics Consortium (MADGC), 613 subjects from the University of California San Francisco (UCSF) Lupus Genetics, and 335 subjects from the University of Pittsburgh Medical Center (UPMC), plus 8 samples collected at The Feinstein Institute for Medical Research. A total of 3583 control samples were examined in the association analyses. As part of this project, 1861 control samples were selected and then genotyped from the New York Cancer Project (NYCP), based on self-described ethnicity, gender and age. In addition, genotype data from 1722 control samples (all self-described North Americans of European descent) were obtained from the publicly available iControlDB database (http://www.illumina.com/pages.ilmn?ID=231).

  Study phs000122

• Genetic Epidemiology of Ovarian Cancer Histotypes

  Epithelial ovarian cancer is a highly fatal malignancy with known genetic etiology; however, it is estimated that a substantial portion of narrow sense heritability remains to be discovered. The goal of this research was to use genetic information from distantly related ovarian cancer cases to identify regions of the genome that may harbor rare risk variants for epithelial ovarian cancer. The study was conducted in the setting of the Utah Population Database, a statewide data resource in which extensive ancestry data are linked to Utah Cancer Registry records. Focusing on families with a statistically significant excess risk of epithelial ovarian cancer, we used the Infinium Global Screening Array v.3.0 to generate germline genotyping data for distantly related cases. We then applied Shared Genomic Segment Analysis to each set of related cases to identify genomic regions that may harbor ovarian cancer risk variants. Eleven regions were identified. Genotype data are available through dbGaP for one case from each pedigree. Genotype data from other ovarian cancer cases within the high-risk pedigrees as well as the pedigrees' corresponding structures can be requested and made available with approval from the Utah Resource for Genetic and Epidemiologic Research (RGE).

  Study phs003140

• HTAN Pilot Project: Single-Cell Transcriptomics Toolbox for Fresh and Frozen Human Tumors (Lung, Breast, Ovarian, Melanoma, Neuroblastoma, Sarcoma, Glioblastoma, Glioma, and Leukemia)

  Single cell transcriptomics is a powerful tool to map the complex tumor microenvironment, providing unprecedented resolution into cell types, cell states, cell interactions, and tumor heterogeneity. Depending on their tissue site and whether processing begins from a fresh or frozen sample, different tumors require different optimizations in order to obtain high quality single cell transcriptomic data. In this study, we profiled a range of tumor types, varying in cell-of-origin, solid and non-solid forms, patient ages, and transitions. The tumors also further varied in their tissue site and in their sample collection method. To enable profiling of such diverse samples, we developed a systematic toolbox for single cell RNA-Seq and single nucleus RNA-Seq of fresh and frozen clinical tumor samples. We validated this toolbox for 216,490 cells and nuclei extracted from 39 samples across 23 tumors (some tumors were split into multiple samples). The 23 tumors represented eight unique tumor types. This toolbox comprises both experimental and computational protocols as well as guidelines for comparing and selecting protocols for the biological problem of interest.

  Study phs001983

• Molecular Determinants of Esophageal Cancer in Tanzania

  We describe the genomic profiles of 61 esophageal squamous cell carcinoma (ESCC) cases from Tanzania and compare them to profiles from an existing cohort of ESCC cases from Malawi. We also provide a comparison to ESCC tumors in The Cancer Genome Atlas Program (TCGA). Despite a high burden of ESCC in Eastern Africa, investigations into the genomics in this region are nascent. This represents the largest comprehensive genomic analysis of ESCC from sub-Saharan Africa to date. We observed substantial transcriptional overlap with other squamous histologies via comparison with TCGA PanCan dataset. DNA analysis revealed known mutational patterns, both genome-wide as well as in genes known to be commonly mutated in ESCC. TP53 mutations were the most common somatic mutation in tumors from both Tanzania and Malawi but were detected at lower frequencies than previously reported in ESCC cases from other settings. In a combined analysis, two unique transcriptional clusters were identified: a proliferative/epithelial cluster and an invasive/migrative/mesenchymal cluster. Mutational signature analysis of the Tanzanian cohort revealed common signatures associated with aging and cytidine deaminase activity and an absence of signature 29, which was previously reported in the Malawi cohort.

  Study phs003217